Dataset for CDS BCL-2-like of organism Jaculus jaculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C5L8K1_BCL2A1-      atg------------------------actgactgtgagtttgca-----
A0A8C5NZI4_BCL2L1-      atg-------------tctcag-----agcaaccgggagctggtggttga
A0A8C5JYS0_BCL2-01      atggcgcacgcggggaccaccgggtacgataaccgggaaatcgtgaggaa
A0A8C5L5C6_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggctga
                        ***                               * *   * *       

A0A8C5L8K1_BCL2A1-      -tacgtccact---cgctggctcaggactacctgcagtgcgtctgg----
A0A8C5NZI4_BCL2L1-      ctttctcacctacaagctttcccagaa------aggatacagctggagtc
A0A8C5JYS0_BCL2-01      ctacatccactataagctgtcgcagag------gggctacgcgtgg----
A0A8C5L5C6_BCL2L2-      ctttgtaggctataagctgagacagaa------gggttatgtctgt----
                         *   *   **    ***    ***            *     **     

A0A8C5L8K1_BCL2A1-      ------------------------------------caggagccctccct
A0A8C5NZI4_BCL2L1-      agtttagtgatgtcgaagagaacaggactgaggccccagaaggga---ct
A0A8C5JYS0_BCL2-01      --------gatgctggcgacgtgggctcggcgaccccgggagccaccccc
A0A8C5L5C6_BCL2L2-      --------ggagctggc---------------------------------

A0A8C5L8K1_BCL2A1-      ctgtccggc--------------tcccagcaa------------------
A0A8C5NZI4_BCL2L1-      gaatcagagatggagacccccagtgctatcaatggtaacccat-------
A0A8C5JYS0_BCL2-01      gcgccgggcatcttctcctcccagcctgggaacgacaccacatcggccgt
A0A8C5L5C6_BCL2L2-      ------------------------cctggaga------------------
                                                 *     *                  

A0A8C5L8K1_BCL2A1-      -----ggcatccag------gct---------------------------
A0A8C5NZI4_BCL2L1-      --cctggcacctggtggacagcccggctgtgaatggagccactggccaca
A0A8C5JYS0_BCL2-01      gccccgggatccag----cagccaggacctcgccgccgccggccgcggcc
A0A8C5L5C6_BCL2L2-      ------gggcccag----cagct---------------------------
                              *   *  *      **                            

A0A8C5L8K1_BCL2A1-      ---------------------------gctacagaaagttgcatt---ct
A0A8C5NZI4_BCL2L1-      gcagcagtttggatgc--ccgggaggtgatccccatggcagcagtgaagc
A0A8C5JYS0_BCL2-01      gcccccgccgggcctctgcctggcccggtcccac----ctgtggtccacc
A0A8C5L5C6_BCL2L2-      ---------------------------gatccac----------ttcacc
                                                   *   *            *     

A0A8C5L8K1_BCL2A1-      cagctcagaaagaagtcga-gaagaatctgaaacc--atacctggagaac
A0A8C5NZI4_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
A0A8C5JYS0_BCL2-01      tgaccctccgccaggccggcgatgacttctcccgccgctaccgccgcgac
A0A8C5L5C6_BCL2L2-      aagccatgagggcagctggagatgagtttgagacccgcttccggcgcacc
                           *          *  *  ** ** *           * **        

A0A8C5L8K1_BCL2A1-      tt---tgaggtgac-------ctccatcgatgatgccagaatca------
A0A8C5NZI4_BCL2L1-      ttcagtgatctaacatcccagcttcat--ataaccccggggacagcatat
A0A8C5JYS0_BCL2-01      ttcgccgagatgtccagccagctgcac--ctgacgcccttcaccgcgcgg
A0A8C5L5C6_BCL2L2-      ttctctgacctagctgctcagctgcat--gtgaccccaggctcagcccag
                        **    **  *  *       ** **    * *  **     *       

A0A8C5L8K1_BCL2A1-      ----tcttcaatcaagtgatggaaaaggaatttgaagatgggatcattaa
A0A8C5NZI4_BCL2L1-      cagagctttgaacaggtagtgaatgaactcttccgggatggggta---aa
A0A8C5JYS0_BCL2-01      gggcgcttcgccacggtggtggaggagctgttccgggacggggtg---aa
A0A8C5L5C6_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggcccc---aa
                             ***       **     *  *    **    *  **       **

A0A8C5L8K1_BCL2A1-      ctgggggcggatagtgaccatatttgcttttgggggtgttct-cctgaag
A0A8C5NZI4_BCL2L1-      ctggggtcgcattgtggccttcttctccttcggcggggcactgtgtgtgg
A0A8C5JYS0_BCL2-01      ctgggggcggatcgtggccttctttgagttcggcggggtcatgtgtgtgg
A0A8C5L5C6_BCL2L2-      ctggggccgcctggtagccttctttgtctttggggctgctctgtgtgctg
                        ****** **  * **  ** * **    ** ** *  *   *   **  *

A0A8C5L8K1_BCL2A1-      aaacttccacgacagcagaccgaccttgatgtggacactaatgag-caga
A0A8C5NZI4_BCL2L1-      aaa-----gcgtagacaag--ga----gatgcaggtgttggtgagtcgga
A0A8C5JYS0_BCL2-01      aga-----gcgtcaaccgg--ga----gatgtcacccctggtggacaaca
A0A8C5L5C6_BCL2L2-      aga-----gtgtcaacaaa--ga----gatggagccactggtgggacaag
                        * *       *    *     **    ****       *  **       

A0A8C5L8K1_BCL2A1-      tttcttcttttgtggctgaattcataacgaataacacaggagaatggata
A0A8C5NZI4_BCL2L1-      ttgcaagttggatgaccacgtacctgaatgaccacctggagccttggatc
A0A8C5JYS0_BCL2-01      tcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatc
A0A8C5L5C6_BCL2L2-      tacaggagtggatggtggcctacctggagacgcgcctggctgactggatc
                        *       *   **      * * *         *         ***** 

A0A8C5L8K1_BCL2A1-      cggcagaacggaggctgggaaa-----acggctttataaagaagtttgaa
A0A8C5NZI4_BCL2L1-      caggagaacggcggctgggacacttttgtggagctctatgggaacaatgc
A0A8C5JYS0_BCL2-01      caggataacggaggctgggacgcctttgtggagctgtac--------ggc
A0A8C5L5C6_BCL2L2-      cacagcagtgggggctgggcggagttcacagctctatacggggacggggc
                        *     *  ** *******           *   * **            

A0A8C5L8K1_BCL2A1-      cccac---------------ctctggctggctggtgcttctggatgttgc
A0A8C5NZI4_BCL2L1-      agcagccgagagccggaagggccaggagcgcttcaaccgctggttcctga
A0A8C5JYS0_BCL2-01      cctggtgta----cgac---ccctgtttgacttctcctggctgtctctga
A0A8C5L5C6_BCL2L2-      cctggaggaggcgcggc---gtctgcgggaggggaactgggcatcagtga
                                              * *           *          ** 

A0A8C5L8K1_BCL2A1-      aggacacat--------------ctgg-----------------------
A0A8C5NZI4_BCL2L1-      cgggca---tgactgtggccggtgtggttctg---------------ctg
A0A8C5JYS0_BCL2-01      agaccctgctgagcctggcc---ctgg---tgggggcgtgtgtgactctg
A0A8C5L5C6_BCL2L2-      ggacagtgctgacaggggcc---gtggcactgggggccctggtaactgta
                         *                      ***                       

A0A8C5L8K1_BCL2A1-      gaaatgctcttttacctgaagcaa
A0A8C5NZI4_BCL2L1-      ggctcgctcttcagtcggaaatga
A0A8C5JYS0_BCL2-01      ggtgcctatctgggccacaagtga
A0A8C5L5C6_BCL2L2-      ggggccttttttgctagcaagtga
                        *         *       **   *

© 1998-2023Legal notice