Dataset for CDS BCL-2-like of organism Jaculus jaculus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C5JYS0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Jaculus jaculus GN=BCL-2 (length=711 residues).
atggcgcacgcggggaccaccgggtacgataaccgggaaatcgtgaggaactacatccactataagctgtcgcagagggg
ctacgcgtgggatgctggcgacgtgggctcggcgaccccgggagccacccccgcgccgggcatcttctcctcccagcctg
ggaacgacaccacatcggccgtgccccgggatccagcagccaggacctcgccgccgccggccgcggccgcccccgccggg
cctctgcctggcccggtcccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcgggggcgcttcgccacggtggtggaggagc
tgttccgggacggggtgaactgggggcggatcgtggccttctttgagttcggcggggtcatgtgtgtggagagcgtcaac
cgggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgcctttgtggagctgtacggccctggtgtacgacccctgtttgacttctcctggctgtctc
tgaagaccctgctgagcctggccctggtgggggcgtgtgtgactctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C5L5C6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgagacagaagggtta
tgtctgtggagctggccctggagagggcccagcagctgatccacttcaccaagccatgagggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgacctagctgctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgcctggtagccttctttgtctttggggctgctctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtacaggagtggatggtggcctacctggagacgcgcc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C5L8K1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2A1 (length=519 residues).
atgactgactgtgagtttgcatacgtccactcgctggctcaggactacctgcagtgcgtctggcaggagccctccctctg
tccggctcccagcaaggcatccaggctgctacagaaagttgcattctcagctcagaaagaagtcgagaagaatctgaaac
catacctggagaactttgaggtgacctccatcgatgatgccagaatcatcttcaatcaagtgatggaaaaggaatttgaa
gatgggatcattaactgggggcggatagtgaccatatttgcttttgggggtgttctcctgaagaaacttccacgacagca
gaccgaccttgatgtggacactaatgagcagatttcttcttttgtggctgaattcataacgaataacacaggagaatgga
tacggcagaacggaggctgggaaaacggctttataaagaagtttgaacccacctctggctggctggtgcttctggatgtt
gcaggacacatctgggaaatgctcttttacctgaagcaa
>gnl|bcl2dbcds|A0A8C5NZI4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctcacctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaagggactgaatcagagatggagacccccagtgctatcaatggta
acccatcctggcacctggtggacagcccggctgtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
tctaacatcccagcttcatataaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggccttcttctccttcggcggggcactgtgtgtggaaagcgtagacaaggagatgcag
gtgttggtgagtcggattgcaagttggatgaccacgtacctgaatgaccacctggagccttggatccaggagaacggcgg
ctgggacacttttgtggagctctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggtgtggttctgctgggctcgctcttcagtcggaaatga
© 1998-2022Legal notice