Dataset for CDS BCL-2-like of organism Echeneis naucrates

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A665VM40_BCL2L1-      atg-------tctcaaaacagagaactg----------------------
A0A665VSD7_BCL2L1-      atg----tcgtacagcaacagagagctg----------------------
A0A665U7Y7_BCL2-01      atggagagcgagtggaaccgcaa---------------------------
A0A665TFT7_MCL1-01      atgagcctttttcaaacacacaagtcttctgccttcgggtccgcctccac
A0A665VTJ8_BCL2L10      atg-----------------------------------------------
                        ***                                               

A0A665VM40_BCL2L1-      ------------------gtt--------gttttctacataaaatataaa
A0A665VSD7_BCL2L1-      ------------------gtg--------gagttcttcatacactccaaa
A0A665U7Y7_BCL2-01      --------------tattgtg--------gaaaattatttacgctataaa
A0A665TFT7_MCL1-01      ctccatgaacctgctaatctgcgacccgaacgtactgccgaagatgtgga
A0A665VTJ8_BCL2L10      --------------tcatgtg--------------------gggtgtgga
                                           *                        *    *

A0A665VM40_BCL2L1-      ctttcccagagaaactatcctctcaaccacatggagttcaatgaatctct
A0A665VSD7_BCL2L1-      ctgcct----ctggcctcgctgctgaggccagagga----------tgct
A0A665U7Y7_BCL2-01      ctcgcc----aaa-cggggctat----gcgtggggatt--------tgat
A0A665TFT7_MCL1-01      ccggcg----gggccggggcctc----ctccgtggact--------ctcc
A0A665VTJ8_BCL2L10      ---aag----agaccttggttgt----ggcagaggactacctataccttt
                                      *                  *                

A0A665VM40_BCL2L1-      tc--acaggactgatggtg-------------------ggggggcag---
A0A665VSD7_BCL2L1-      ggtggacagactgaaggagaca------------------aggccaact-
A0A665U7Y7_BCL2-01      gacgtccggaatgaagatgctg----------ctactaatggctcaata-
A0A665TFT7_MCL1-01      ga--tccggagcgacgtcgccaaacgacccaccaacctggaggtgagctc
A0A665VTJ8_BCL2L10      gc--tgcacaaagccacagccagcacccccacctcccagcgaatcagcc-
                                 *  *     *                          *    

A0A665VM40_BCL2L1-      -------ggttggttgaagaacaaagggtagcaacgcattccaacggaac
A0A665VSD7_BCL2L1-      ------cagctgct---------------aggaatggcctacctgtcatc
A0A665U7Y7_BCL2-01      --------gttgccccatccccgactttggtccgccggttccgcgaagcc
A0A665TFT7_MCL1-01      taaaggcggctgcccgcc-----------gaaaatcgt--ccgggaaaac
A0A665VTJ8_BCL2L10      --------gctgcc--at-----------gaggaccgtggcccaggacat
                                * **                             *        

A0A665VM40_BCL2L1-      ttttaatggcacaagttctggaacccggtcagagtccccac---------
A0A665VSD7_BCL2L1-      ----agtgggag------------catgctgagttacacta---------
A0A665U7Y7_BCL2-01      ----agcagcgg-------gcccgacaaccagagcgcgccc----gagcg
A0A665TFT7_MCL1-01      ----agcggcgg-------ggagtccg--tagcttgcaccccggagagca
A0A665VTJ8_BCL2L10      ----ggaggcgc-------agcaccaggctcgcttccactcccttg----
                                *                           * *           

A0A665VM40_BCL2L1-      --aggggcagcaacacttggcatcaatgacaagcctggatgcagt-----
A0A665VSD7_BCL2L1-      ----ggac------------ccccccacccccaccatgtgacattgaagc
A0A665U7Y7_BCL2-01      gtacggac-----------ggccccc--------------gcagt----c
A0A665TFT7_MCL1-01      actcagacagcgaggccgaggcctcctctccggccgagagggag-----c
A0A665VTJ8_BCL2L10      -ttcagac-------------cttcct----------gaagcagt----c
                             * *                                  *       

A0A665VM40_BCL2L1-      ---gaaggaggccctcct---------------ggattctgccaa---cg
A0A665VSD7_BCL2L1-      tgtaaaggaagctctta---------------gggactctactga---tg
A0A665U7Y7_BCL2-01      cgacccgaacgccgacatccacagagtcctccgggaggccggaga---cg
A0A665TFT7_MCL1-01      tgctcagggccgatacat--------------gccag-ctcataagccag
A0A665VTJ8_BCL2L10      tgggcaggacccct--gt--------------ggcagcctcagga-----
                              *                            *  *     *     

A0A665VM40_BCL2L1-      agtttgaattgcgatactcccgcgccttc-------agcgacttgcacaa
A0A665VSD7_BCL2L1-      agtttgaattcctcttcaggcaagcattt-------agtgacctttcctc
A0A665U7Y7_BCL2-01      aacttgagaggttgtaccagccggacttc-------acggagatgtcccg
A0A665TFT7_MCL1-01      accatgaggtggtacaccgagtggtccacgccgaggacgaagcagcacag
A0A665VTJ8_BCL2L10      ------aggtgatggaggagctggt------------------------g
                              *                *                          

A0A665VM40_BCL2L1-      ccagctgcatatc--------------------acaccggccacagctta
A0A665VSD7_BCL2L1-      acagcttgacatc--------------------acttctgacacagtcta
A0A665U7Y7_BCL2-01      gcagctgtacatc---------------tcctcctccgtggcgcag----
A0A665TFT7_MCL1-01      agggctggacaccatgaagagagtcgtggacgggctcctggagaag----
A0A665VTJ8_BCL2L10      ggagatggacact-tgaa-------------------ctgggggag----
                           * *  * *                            *    **    

A0A665VM40_BCL2L1-      cataag-------------ctttgaaaacgtgatggatgaagtgttccgt
A0A665VSD7_BCL2L1-      ccagag-------------cttcgagaccgtgatggatgaggtgttcaag
A0A665U7Y7_BCL2-01      -aggag-------gttcgcc------gaggtgatagacgaactcttccgg
A0A665TFT7_MCL1-01      -cacgg-------aatcgcctacaatggtatggtcaacaaactgtcactg
A0A665VTJ8_BCL2L10      -ggtggtttccattttcacctttactggggtgctggccagacagctgctg
                             *             *          ** *                

A0A665VM40_BCL2L1-      gacggcgtcaactggggccgcatcatagggctttttgtgtttggt-----
A0A665VSD7_BCL2L1-      gatggcatcaactgggggcggatagtggccctgtttgcctttggg-----
A0A665U7Y7_BCL2-01      gacggagtgaactggggccggattatcgccttcttcgagttcggg-----
A0A665TFT7_MCL1-01      gacaacacaga--g-gacatgagttttgtctgtttggtggcccagaaact
A0A665VTJ8_BCL2L10      ga----gcaga--gtggcatgaatccgg---ggctggaccctgggaaa--
                        **        *  * *     *     *      * *             

A0A665VM40_BCL2L1-      -----------------------ggggcactatgtgtcgagtgcgt---g
A0A665VSD7_BCL2L1-      -----------------------ggtgaactttgtgtggaatgtgt---t
A0A665U7Y7_BCL2-01      -----------------------ggggccgtgtgcgtcgagtgcgcggcc
A0A665TFT7_MCL1-01      cttctcagacggcaccaccaactggggccgtgtggccagcctggccgcct
A0A665VTJ8_BCL2L10      ------------------aaactgggacaggg------gcctggac-tct
                                               **             *  **       

A0A665VM40_BCL2L1-      gagaaggagatgagtccactggtggtcaggatcattgaatggatgacagt
A0A665VSD7_BCL2L1-      gagaagaatatgagtgagatggttcccagcattgcagagtggatgaccat
A0A665U7Y7_BCL2-01      aaggaggagttgagcccgcaggtggacaacgtcgcggagtggatgacgga
A0A665TFT7_MCL1-01      tcggggtggtggtgt-----gtcggaggctgaaggagatgggcagggaga
A0A665VTJ8_BCL2L10      gcaggggactgg----------cggagaccatagctgattacctgggaga
                             *     *                        **      *     

A0A665VM40_BCL2L1-      c-----------------------------------------tacctgga
A0A665VSD7_BCL2L1-      a-----------------------------------------tacttgga
A0A665U7Y7_BCL2-01      g-----------------------------------------tatttaaa
A0A665TFT7_MCL1-01      gctgtgtggaatctgtaggaatggagatctccaaatacctgttgtctgaa
A0A665VTJ8_BCL2L10      g----------------------------------------------gag
                                                                          

A0A665VM40_BCL2L1-      caacaacattcagccctggatccagggtcaaggaggatgggagcattttg
A0A665VSD7_BCL2L1-      tttgcacatccgtccatggatcgagacgcaaggaggctgggactgctttg
A0A665U7Y7_BCL2-01      cggacctcttaacagctggataaaggataacgggggatgggatgcctttg
A0A665TFT7_MCL1-01      cag-------aaggactggctgctgaagaacaattcatgggatggctttg
A0A665VTJ8_BCL2L10      aag-------aaagactggctgctggagaatgatggatgggagggattct
                                        *** *   *    *       *****    **  

A0A665VM40_BCL2L1-      ctgaactctttgggcacgatgctgcagcggagagcagaaggtca------
A0A665VSD7_BCL2L1-      ctgagattttt---------------gggcagaactccgctgcaacagcg
A0A665U7Y7_BCL2-01      tggagctgtat---gacaga-----cagggcgactccatcttcagctgct
A0A665TFT7_MCL1-01      tggagttcttt---cacgtt---------gtggacccagagtca------
A0A665VTJ8_BCL2L10      gtaagttctct---caaagtgccagagaggtgagtcaggactcg------
                           *  * * *                    *          *       

A0A665VM40_BCL2L1-      ----------caggaaagtttcaccaa--gtggctgctggcaggaatgac
A0A665VSD7_BCL2L1-      aggagatctca--ggaggctgcgaggag-gtggctgctagttggagtggc
A0A665U7Y7_BCL2-01      cctggccctccatcaagacggtcttcggtctggctgca-ctcggggccgc
A0A665TFT7_MCL1-01      --------tcagtgaggaacacactc---atggccttt-gctggagtggc
A0A665VTJ8_BCL2L10      --------tcaatgaagacggcgctg---tttgctgct-gctggcgtg--
                                                      * **        **      

A0A665VM40_BCL2L1-      cctgctgactggagttgtggtggggtcactgatcgccagaaagcgcctgt
A0A665VSD7_BCL2L1-      gctgctgacaggagtgctgatgggtgtgctcattgct---aagaaacagt
A0A665U7Y7_BCL2-01      cagcctcaccatcgg-------agcataccttacaca---gaag-----t
A0A665TFT7_MCL1-01      aggcatcggcgcaac-------actggccctgttgat---caga-----t
A0A665VTJ8_BCL2L10      -ggcctcgctggact-------caccttcctcctggt---acgc-----t
                             *                      *                    *

A0A665VM40_BCL2L1-      ga
A0A665VSD7_BCL2L1-      ga
A0A665U7Y7_BCL2-01      ga
A0A665TFT7_MCL1-01      ga
A0A665VTJ8_BCL2L10      ag
                          

© 1998-2020Legal notice