Dataset for CDS BCL-2-like of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3NFM4_BCL2L1-      atg-----------------------------------------------
A0A3Q3MEY1_BCL2-01      atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataa
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-05      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      atg----tc----------tcaaaacag----------------------
A0A7N8WMH7_BCL2L10      atg----tcgtgtgggctgtggaaagag--acc-----------------
A0A3Q3S6A5_MCL1-01      atgagcttcattccgtcgacgagacgagccgcc-----------------
A0A3Q3S6A5_MCL1-02      atgagcttcattccgtcgacgagacgagccgcc-----------------
                                                                          

A0A3Q3NFM4_BCL2L1-      ------------------------------------tcgtacagtaacag
A0A3Q3MEY1_BCL2-01      actctccaaacg-------------------cggctacgtgtgg----gg
A0A3Q3MEY1_BCL2-02      -------------------------------atgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-10      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-08      -------------------------------actcatctattgg------
A0A3Q3MEY1_BCL2-04      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-05      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-07      -------------------------------atgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-09      -------------------------------atgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-03      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-06      -------------------------------atgcttcttgtagttgccg
A0A3Q3MX20_BCL2L1-      ---------------------------------ggaactggtgg------
A0A7N8WMH7_BCL2L10      -------------------------------ctggctctggcag--agga
A0A3Q3S6A5_MCL1-01      -------------------------------ctcatacccggagtcatga
A0A3Q3S6A5_MCL1-02      -------------------------------ctcatacccggagtcatga
                                                             *     *      

A0A3Q3NFM4_BCL2L1-      ----------------------------agagctggtggagttctttatt
A0A3Q3MEY1_BCL2-01      atttcataacgtccaggatgaagatgctgctaataatg--gctctgtagt
A0A3Q3MEY1_BCL2-02      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-10      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-08      -----------acctttgggtt---------tatgatct-----------
A0A3Q3MEY1_BCL2-04      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-05      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-07      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-09      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-03      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-06      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MX20_BCL2L1-      ----t-----tttc-----------------------tacataaaatata
A0A7N8WMH7_BCL2L10      ttacc-----tgtc-----------------------cctgtgctgcaca
A0A3Q3S6A5_MCL1-01      tcgtc-----cttccccaagatggagtcctggagggacccgtgcactacg
A0A3Q3S6A5_MCL1-02      tcgtc-----cttccccaagatggagtcctggagggacccgtgcactacg
                                                                          

A0A3Q3NFM4_BCL2L1-      agcta-------caagctgtctcagaag-----aactacccgacctctct
A0A3Q3MEY1_BCL2-01      tgccc---------------ctccg--------ccgactgtggtccgc--
A0A3Q3MEY1_BCL2-02      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MEY1_BCL2-10      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MEY1_BCL2-08      ---cc-------tgact---cttttgaa-----ct--------------t
A0A3Q3MEY1_BCL2-04      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MEY1_BCL2-05      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MEY1_BCL2-07      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MEY1_BCL2-09      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MEY1_BCL2-03      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MEY1_BCL2-06      agccc-------caaac---ctctgaaa-----ctgaacggggcccacgt
A0A3Q3MX20_BCL2L1-      aactctcccagagaaactatcctctcat-----ctacatagaactc----
A0A7N8WMH7_BCL2L10      agccc------acagtcagtccctccac-----------------ctccc
A0A3Q3S6A5_MCL1-01      actcc------agag---atccctccacacagtttaccttggactctcgc
A0A3Q3S6A5_MCL1-02      actcc------agag---atccctccacacagtttaccttggactctcgc
                                            *                             

A0A3Q3NFM4_BCL2L1-      g--------------------ctgaggccagaaga------tgctggtgg
A0A3Q3MEY1_BCL2-01      ----------------------cggtgccgtgacg------c--------
A0A3Q3MEY1_BCL2-02      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-10      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-08      t--------------------caggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-04      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-05      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-07      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-09      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-03      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MEY1_BCL2-06      c--------------------gtggtgacaggagg------ctcaagtgg
A0A3Q3MX20_BCL2L1-      --aatgagcaacagaacaggactgatg-ggggaga-----ggctgagtca
A0A7N8WMH7_BCL2L10      a---------gcgagtcag--ctgctgccatgagatgtctggcccagaaa
A0A3Q3S6A5_MCL1-01      aacgggaacggcgggacgg--ctaatccgaaaaga-------cccaagaa
A0A3Q3S6A5_MCL1-02      aacgggaacggcgggacgg--ctaatccgaaaaga-------cccaagaa
                                                        *                 

A0A3Q3NFM4_BCL2L1-      aa----------------ggacagaggga-----------------gaca
A0A3Q3MEY1_BCL2-01      ---------gagc-accgggcccgacagc-----------------ga--
A0A3Q3MEY1_BCL2-02      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-10      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-08      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-04      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-05      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-07      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-09      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-03      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MEY1_BCL2-06      aattgggaagtgc-atcgcgatcgagtgc-----------------taca
A0A3Q3MX20_BCL2L1-      ggtgaggaacagcggatagcaacgcatgc-caacgggacttttaatg---
A0A7N8WMH7_BCL2L10      atggagaggcagc-accaggctcgcttccac-------tccctc------
A0A3Q3S6A5_MCL1-01      cctggaagtcagc-tccacaaacgggtacgcgacaaaatccatcgtggcc
A0A3Q3S6A5_MCL1-02      cctggaagtcagc-tccacaaacgggtacgcgacaaaatccatcgtggcc
                                               *                          

A0A3Q3NFM4_BCL2L1-      tgaccggtg-------------------cagctgccaccaacggcttgct
A0A3Q3MEY1_BCL2-01      ------gag-------------------catccccca-------------
A0A3Q3MEY1_BCL2-02      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-10      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-08      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-04      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-05      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-07      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-09      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-03      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MEY1_BCL2-06      ggcaaggag-------------------cgttcatcact-----ctggtg
A0A3Q3MX20_BCL2L1-      -gcacaagt----------------------cctg---------------
A0A7N8WMH7_BCL2L10      -actcagac-------------------tttcctgaa----------gca
A0A3Q3S6A5_MCL1-01      gacacggacgacatagaggacgggtcgttaccctgcaccccggagctgca
A0A3Q3S6A5_MCL1-02      gacacggacgacatagaggacgggtcgttaccctgcaccccggagctgca
                                                                          

A0A3Q3NFM4_BCL2L1-      ggtcaacagcagg-tatgtcagcggccggccgg-----------------
A0A3Q3MEY1_BCL2-01      gctctgcagagggctccctcagt--ccgaccca-----------------
A0A3Q3MEY1_BCL2-02      gcacgagatgagactaagttgct--tcaagcaa------aaaaagaggtg
A0A3Q3MEY1_BCL2-10      gcacgagatgagcctg-gttgtc--t------------------------
A0A3Q3MEY1_BCL2-08      gcacgagatgagactaagttgct--tcaagcaa------aaaaagaggtg
A0A3Q3MEY1_BCL2-04      gcacgagatgagccgatgccatt--taacttaaggtttcataagactgtg
A0A3Q3MEY1_BCL2-05      gcacgagatgagactaagttgct--tcaagcaa------aaaaagaggtg
A0A3Q3MEY1_BCL2-07      gcacgagatgagactaagttgct--tcaagcaa------aaaaagaggtg
A0A3Q3MEY1_BCL2-09      gcacgagatgagactaagttgct--tcaagcaa------aaaaagaggtg
A0A3Q3MEY1_BCL2-03      gcacgagatgagactaagttgct--tcaagcaa------aaaaagaggtg
A0A3Q3MEY1_BCL2-06      gcacgagatgagactaagttgct--tcaagcaa------aaaaagaggtg
A0A3Q3MX20_BCL2L1-      ----ggacc------cccccagcgtccccgct------------------
A0A7N8WMH7_BCL2L10      gtgcgggccg----gacccctgct--ccagcc------------------
A0A3Q3S6A5_MCL1-01      gt-cggacagcgaagcccccagctgcccggccggggacgaggtcctggag
A0A3Q3S6A5_MCL1-02      gt-cggacagcgaagcccccagctgcccggccggggacgaggtcctggag
                                                                          

A0A3Q3NFM4_BCL2L1-      --ggatgtca------tcat-------------------ccccacatgga
A0A3Q3MEY1_BCL2-01      ---caagccg------ccattca-----------cagagtcctgcgcgag
A0A3Q3MEY1_BCL2-02      gagaaatttg------ccattaatgacaagcaggtggtgctctgcatatc
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      gagaaatttg------ccattaatgacaagcaggtggtgctctgcatatc
A0A3Q3MEY1_BCL2-04      tacaatttct------taatt---------caggtggtgctctgcatatc
A0A3Q3MEY1_BCL2-05      gagaaatttg------ccattaatgacaagcaggtatgggttt--atttg
A0A3Q3MEY1_BCL2-07      gagaaatttg------ccattaatgacaagcaggtggtgctctgcatatc
A0A3Q3MEY1_BCL2-09      gagaaatttg------ccattaatgacaagcaggtggtgctctgcatatc
A0A3Q3MEY1_BCL2-03      gagaaatttg------ccattaatgacaagcaggtggtgctctgcatatc
A0A3Q3MEY1_BCL2-06      gagaaatttg------ccattaatgacaagcaggtggtgctctgcatatc
A0A3Q3MX20_BCL2L1-      -------gcgacaagaacatttgcagtccacggcaag-------------
A0A7N8WMH7_BCL2L10      -------tcaggaaggttat-------------agaggag----------
A0A3Q3S6A5_MCL1-01      aacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggact
A0A3Q3S6A5_MCL1-02      aacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggact
                                                                          

A0A3Q3NFM4_BCL2L1-      ggcgta--------gaggctgtaaaggcagctcttagggactccgct---
A0A3Q3MEY1_BCL2-01      gctgga----------------ga-----------------tgaact---
A0A3Q3MEY1_BCL2-02      ggtggatgtttccagtgattataa-----------------tcaggt---
A0A3Q3MEY1_BCL2-10      ------------------ttatag-----------------ccaggt---
A0A3Q3MEY1_BCL2-08      ggtggatgtttccagtgattataa-----------------tcaggt---
A0A3Q3MEY1_BCL2-04      ggtggatgtttccagtgattataa-----------------tcaggt---
A0A3Q3MEY1_BCL2-05      agtaga-------agtgacttttt-----------------tgctgt---
A0A3Q3MEY1_BCL2-07      ggtggatgtttccagtgattataa-----------------tcaggt---
A0A3Q3MEY1_BCL2-09      ggtggatgtttccagtgattataa-----------------tcaggt---
A0A3Q3MEY1_BCL2-03      ggtggatgtttccagtgattataa-----------------tcaggt---
A0A3Q3MEY1_BCL2-06      ggtggatgtttccagtgattataa-----------------tcaggt---
A0A3Q3MX20_BCL2L1-      --------cctggatgca--gtgaaagaggccctccgggactcagcc---
A0A7N8WMH7_BCL2L10      ---------ctggtggca--------------gatggacacttgaac---
A0A3Q3S6A5_MCL1-01      ttctaaaccccggtggcacgactccaaagcactgtcgacaatgaaacgag
A0A3Q3S6A5_MCL1-02      ttctaaaccccggtggcacgactccaaagcactgtcgacaatgaaacgag
                                                                          

A0A3Q3NFM4_BCL2L1-      -----gaagagtttg-------------------aactgctcttcactca
A0A3Q3MEY1_BCL2-01      -----tgaaagactg---------------tatcagccggactttacgga
A0A3Q3MEY1_BCL2-02      -----ggaaagtgtgataaaacaggctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-10      -----gaaaa------------acgctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-08      -----ggaaagtgtgataaaacaggctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-04      -----ggaaagtgtgataaaacaggctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-05      -----------tgtg------caggctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-07      -----ggaaagtgtgataaaacaggctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-09      -----ggaaagtgtgataaaacaggctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-03      -----ggaaagtgtgataaaacaggctcaagaaaagctgggacctgttga
A0A3Q3MEY1_BCL2-06      -----ggaaagtgtgataaaacaggctcaagaaaagctgggacctgttga
A0A3Q3MX20_BCL2L1-      -----aacgagtttg-------------------agctacgatacgcccg
A0A7N8WMH7_BCL2L10      -tgggggagggttgt-------------------t-------tccctttt
A0A3Q3S6A5_MCL1-01      ttgtggaagaccttt-------------------tggaaaaatacagata
A0A3Q3S6A5_MCL1-02      ttgtggaagaccttt-------------------tggaaaaatacagata
                                                                          

A0A3Q3NFM4_BCL2L1-      ggcgtttagtgacctttcctc-acagcttgac----------------at
A0A3Q3MEY1_BCL2-01      ga-------------tgtcgcgacagctgtat----------------ct
A0A3Q3MEY1_BCL2-02      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-10      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-08      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-04      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-05      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-07      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-09      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-03      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MEY1_BCL2-06      tatgcttgtgaactgtgctggaacatctgttt----------------ct
A0A3Q3MX20_BCL2L1-      tgctttcagcga-tctgcacaaccagctgcat----------------at
A0A7N8WMH7_BCL2L10      cacctttactgg-ggtg---------ctgtcc-------agacagctgat
A0A3Q3S6A5_MCL1-01      cacatacaatgg-tatgatcaacaaactgtccttggacgacagaggtgat
A0A3Q3S6A5_MCL1-02      cacatacaatgg-tatgatcaacaaactgtccttggacgacagaggtgat
                                       *          **                     *

A0A3Q3NFM4_BCL2L1-      cactcctg---acacagcttaccacagctttaaaagcgtgatggatgagg
A0A3Q3MEY1_BCL2-01      cacctcca---ccacggcgcagaggcgattcgccgaggtgatagatgaac
A0A3Q3MEY1_BCL2-02      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-10      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-08      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-04      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-05      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-07      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-09      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-03      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MEY1_BCL2-06      ----------------------ggaaagtttgaggaagtgg-aggtggac
A0A3Q3MX20_BCL2L1-      cacgccag---ccacggcctaccaaagcttcgagagtgtgatggatgaag
A0A7N8WMH7_BCL2L10      ggagcagaag-----ggc--a-tgaagc--c-agggctggactctggaaa
A0A3Q3S6A5_MCL1-01      gatgtgagattcgtcagc--actgtagc--caagagcctgtttgctgatg
A0A3Q3S6A5_MCL1-02      gatgtgagattcgtcagc--actgtagc--caagagcctgtttgctgatg
                                                               *      *   

A0A3Q3NFM4_BCL2L1-      tgttcaaggat-------ggagtcaactg---------------------
A0A3Q3MEY1_BCL2-01      tgttccgggac-------ggggtgaactg---------------------
A0A3Q3MEY1_BCL2-02      cgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaac
A0A3Q3MEY1_BCL2-10      cgttttaaa-----------------------------------------
A0A3Q3MEY1_BCL2-08      cgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaac
A0A3Q3MEY1_BCL2-04      cgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaac
A0A3Q3MEY1_BCL2-05      cgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaac
A0A3Q3MEY1_BCL2-07      cgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaac
A0A3Q3MEY1_BCL2-09      cgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaac
A0A3Q3MEY1_BCL2-03      cgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaac
A0A3Q3MEY1_BCL2-06      cgttttaaa-----------------------------------------
A0A3Q3MX20_BCL2L1-      tgttccgggac-------ggtgtcaactg---------------------
A0A7N8WMH7_BCL2L10      gg----------------ggcaggaattg---------------------
A0A3Q3S6A5_MCL1-01      gg----------------accaccaactg---------------------
A0A3Q3S6A5_MCL1-02      gg----------------accaccaactg---------------------
                         *                                                

A0A3Q3NFM4_BCL2L1-      ------------------------gggacgcatagtgggcc------tgt
A0A3Q3MEY1_BCL2-01      ------------------------------------gggccggatta---
A0A3Q3MEY1_BCL2-02      tcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgt
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      tcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgt
A0A3Q3MEY1_BCL2-04      tcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgt
A0A3Q3MEY1_BCL2-05      tcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgt
A0A3Q3MEY1_BCL2-07      tcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgt
A0A3Q3MEY1_BCL2-09      tcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgt
A0A3Q3MEY1_BCL2-03      tcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgt
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      ------------------------gggtcgcatcatagggc------ttt
A0A7N8WMH7_BCL2L10      ------------------------ggacagg-------------------
A0A3Q3S6A5_MCL1-01      ------------------------gggtcggatcgccagcc------tgg
A0A3Q3S6A5_MCL1-02      ------------------------gggtcggatcgccagcc------tgg
                                                                          

A0A3Q3NFM4_BCL2L1-      ttgctttcggt-------------------------ggtgtactgt----
A0A3Q3MEY1_BCL2-01      tcgctttcttcga------------------gttcggcggcaccgtgt--
A0A3Q3MEY1_BCL2-02      ttgtgtcctcccaagctggccagattggcctgtttggatacactgcatac
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ttgtgtcctcccaagctggccagattggcctgtttggatacactgcatac
A0A3Q3MEY1_BCL2-04      ttgtgtcctcccaagctggccagattggcctgtttggatacactgcatac
A0A3Q3MEY1_BCL2-05      ttgtgtcctcccaagctggccagattggcctgtttggatacactgcatac
A0A3Q3MEY1_BCL2-07      ttgtgtcctcccaagctggccagattggcctgtttggatacactgcatac
A0A3Q3MEY1_BCL2-09      ttgtgtcctcccaagctggccagattggcctgtttggatacactgcatac
A0A3Q3MEY1_BCL2-03      ttgtgtcctcccaagctggccagattggcctgtttggatacactgcatac
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      ttgcattcggc-------------------------ggggctctgt----
A0A7N8WMH7_BCL2L10      -ggcctgag---------------------------ag------------
A0A3Q3S6A5_MCL1-01      tggccttcg---------------------------gggccgtggt----
A0A3Q3S6A5_MCL1-02      tggccttcg---------------------------gggccgtggt----
                                                                          

A0A3Q3NFM4_BCL2L1-      -----------gtgtggaatgc---attgagaaga--------acatgag
A0A3Q3MEY1_BCL2-01      -----------gcgtggagtgcgcggccaaggagg--------agatgac
A0A3Q3MEY1_BCL2-02      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-04      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-05      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-07      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-09      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-03      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      -----------gtgtcgagtgt---gtggagaagg--------agatgag
A0A7N8WMH7_BCL2L10      -------------------------ctgcagggg----------------
A0A3Q3S6A5_MCL1-01      -----------gtgtc-agtac---ctgaaggag----------------
A0A3Q3S6A5_MCL1-02      -----------gtgtc-agtac---ctgaaggag----------------
                                                                          

A0A3Q3NFM4_BCL2L1-      tgcgctggtgtcccgcatc-------------------------------
A0A3Q3MEY1_BCL2-01      atcgcaagtggacaacatc-------------------------------
A0A3Q3MEY1_BCL2-02      gataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      gataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MEY1_BCL2-04      gataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MEY1_BCL2-05      gataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MEY1_BCL2-07      gataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MEY1_BCL2-09      gataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MEY1_BCL2-03      gataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MEY1_BCL2-06      -ataaagccgtacaacatctatgtgaccgtggcctacccgccagacacag
A0A3Q3MX20_BCL2L1-      tccactggtgggcaggatt-----------------------------gt
A0A7N8WMH7_BCL2L10      ---actggca---gagacc-----------------------------at
A0A3Q3S6A5_MCL1-01      ---aaaggcaggggggact-----------------------------gt
A0A3Q3S6A5_MCL1-02      ---aaaggcaggggggact-----------------------------gt
                                                                          

A0A3Q3NFM4_BCL2L1-      -----------------gcagattggatgaccatgtatctggatgagcac
A0A3Q3MEY1_BCL2-01      -----------------gcggagtggatgacggagtattt--------aa
A0A3Q3MEY1_BCL2-02      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MEY1_BCL2-04      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MEY1_BCL2-05      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MEY1_BCL2-07      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MEY1_BCL2-09      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MEY1_BCL2-03      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MEY1_BCL2-06      acactccaggattggctgaggaaaataagacaaagcctctaga-gaccaa
A0A3Q3MX20_BCL2L1-      -------------------ggagtggatgaccctctacctggacaaccac
A0A7N8WMH7_BCL2L10      ----agctgattacctgggagaggaga-----------------------
A0A3Q3S6A5_MCL1-01      gtggagctgg-----tggggcaggagatctccacctacctgctgtcagac
A0A3Q3S6A5_MCL1-02      gtggagctgg-----tggggcaggagatctccacctacctgctgtcagac
                                                                          

A0A3Q3NFM4_BCL2L1-      atcagtccgtggatcgagagccaaggaggctgg-------------gact
A0A3Q3MEY1_BCL2-01      atggacctctt-aac------------agctgg-----------------
A0A3Q3MEY1_BCL2-02      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MEY1_BCL2-04      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MEY1_BCL2-05      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MEY1_BCL2-07      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MEY1_BCL2-09      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MEY1_BCL2-03      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MEY1_BCL2-06      attaatctctgaaac------------atctggcgtttgtcaaccagagc
A0A3Q3MX20_BCL2L1-      attgagccctggatccaaagccagggaggatgg-------------gagc
A0A7N8WMH7_BCL2L10      -agaaagactggctgcaagagaatgacggatgg-------------gaag
A0A3Q3S6A5_MCL1-01      cagcgggactggctggtcaaaaacaactcctgg-------------gatg
A0A3Q3S6A5_MCL1-02      cagcgggactggctggtcaaaaacaactcctgg-------------gatg
                                                                          

A0A3Q3NFM4_BCL2L1-      gctttgctgagatttttgggcgagatgcagctgcagaagcaa--------
A0A3Q3MEY1_BCL2-01      -----------------atacaagata-----acggggga----------
A0A3Q3MEY1_BCL2-02      aagtggccaaaattgttgtgcgagatgcag-tacaggggaacttcaacag
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      aagtggccaaaattgttgtgcgagatgcag-tacaggggaacttcaacag
A0A3Q3MEY1_BCL2-04      aagtggccaaaattgttgtgcgagatgcag-tacaggggaacttcaacag
A0A3Q3MEY1_BCL2-05      aagtggccaaaattgttgtgcgagatgcag-tacaggggaacttcaacag
A0A3Q3MEY1_BCL2-07      aagtggccaaaattgttgtgcgagatgcag-tacaggggaacttcaacag
A0A3Q3MEY1_BCL2-09      aagtggccaaaattgttgtgcgagatgca---------------------
A0A3Q3MEY1_BCL2-03      aagtggccaaaattgttgtgcgagatgcag-tacaggggaacttcaacag
A0A3Q3MEY1_BCL2-06      aagtggccaaaattgttgtgcgagatgcag-tacaggggaacttcaacag
A0A3Q3MX20_BCL2L1-      actttgctgaaatctttgggcaggatgcagcagcagagagca--------
A0A7N8WMH7_BCL2L10      ggttctgcaagttctcccacagcgccagagaggtcag-------------
A0A3Q3S6A5_MCL1-01      gctttgtagagttttttc---------gagtagcaga-------------
A0A3Q3S6A5_MCL1-02      gctttgtagagttttttc---------gagtagcaga-------------
                                                                          

A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      -----tggga----------------------------------------
A0A3Q3MEY1_BCL2-02      ttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgt
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgt
A0A3Q3MEY1_BCL2-04      ttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgt
A0A3Q3MEY1_BCL2-05      ttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgt
A0A3Q3MEY1_BCL2-07      ttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgt
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      ttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgt
A0A3Q3MEY1_BCL2-06      ttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgt
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A7N8WMH7_BCL2L10      --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      -------------------------------------tgcctttgtggag
A0A3Q3MEY1_BCL2-02      cacctgtcacgtccatcacagaagctctccagcaggatgcctttgtggag
A0A3Q3MEY1_BCL2-10      -----------------------------------attattaccatgg--
A0A3Q3MEY1_BCL2-08      cacctgtcacgtccatcacagaagctctccagcagattattaccatgg--
A0A3Q3MEY1_BCL2-04      cacctgtcacgtccatcacagaagctctccagcagattattaccatgg--
A0A3Q3MEY1_BCL2-05      cacctgtcacgtccatcacagaagctctccagcagattattaccatgg--
A0A3Q3MEY1_BCL2-07      cacctgtcacgtccatcacagaagctctccagcagattattaccatgg--
A0A3Q3MEY1_BCL2-09      -----------------------------------attattaccatgg--
A0A3Q3MEY1_BCL2-03      cacctgtcacgtccatcacagaagctctccagcagattattaccatgg--
A0A3Q3MEY1_BCL2-06      cacctgtcacgtccatcacagaagctctccagcagattattaccatgg--
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A7N8WMH7_BCL2L10      --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q3NFM4_BCL2L1-      ------------------------------ggagatcacaggaaaccctg
A0A3Q3MEY1_BCL2-01      atgtatgacaggcagagggagtctgtcttcagttgttcctggccctccat
A0A3Q3MEY1_BCL2-02      atgtatgacaggcagagggagtctgtcttcagttgttcctggccctccat
A0A3Q3MEY1_BCL2-10      ------------------------------ggttatttcggaccatc---
A0A3Q3MEY1_BCL2-08      ------------------------------ggttatttcggaccatc---
A0A3Q3MEY1_BCL2-04      ------------------------------ggttatttcggaccatc---
A0A3Q3MEY1_BCL2-05      ------------------------------ggttatttcggaccatc---
A0A3Q3MEY1_BCL2-07      ------------------------------ggttatttcggaccatc---
A0A3Q3MEY1_BCL2-09      ------------------------------ggttatttcggaccatc---
A0A3Q3MEY1_BCL2-03      ------------------------------ggttatttcggaccatc---
A0A3Q3MEY1_BCL2-06      ------------------------------ggttatttcggaccatc---
A0A3Q3MX20_BCL2L1-      ------------------------------ggaggtcccaagagaatttc
A0A7N8WMH7_BCL2L10      -------------------------------------ccacgactcatcc
A0A3Q3S6A5_MCL1-01      -------------------------------------cccagagtccacg
A0A3Q3S6A5_MCL1-02      -------------------------------------cccagagtccacg
                                                              *           

A0A3Q3NFM4_BCL2L1-      aggaggtggctgctagttggag---------------tggcgctgctaac
A0A3Q3MEY1_BCL2-01      caaaacagtcttcggcctgg----------ctgcacttggggcagctagc
A0A3Q3MEY1_BCL2-02      caaaacagtcttcggcctgg----------ctgcacttggggcagctagc
A0A3Q3MEY1_BCL2-10      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MEY1_BCL2-08      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MEY1_BCL2-04      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MEY1_BCL2-05      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MEY1_BCL2-07      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MEY1_BCL2-09      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MEY1_BCL2-03      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MEY1_BCL2-06      ----gccctcttctacctggggagttttgacagcattgtacgccgct-gc
A0A3Q3MX20_BCL2L1-      aagaagtggctgctggcaggga---------------tgacgctggtgac
A0A7N8WMH7_BCL2L10      atgaagacagcgctgtt--tgc---------------tgctgctggag--
A0A3Q3S6A5_MCL1-01      gtgaggcacacactgat--ggc---------------tgttgctggtg--
A0A3Q3S6A5_MCL1-02      gtgaggcacacactgat--ggc---------------tgttgctggtg--
                                    *                            ** *     

A0A3Q3NFM4_BCL2L1-      gggagtgctgataggtgtgctca-------tcgctaagaaacagtga---
A0A3Q3MEY1_BCL2-01      attact----atcggagcat--------accttaca--cagaagtga---
A0A3Q3MEY1_BCL2-02      attact----atcggagcat--------accttaca--cagaagtga---
A0A3Q3MEY1_BCL2-10      atgatt--cagagggagcagtcaaaatcagctgacaagagggagtaa---
A0A3Q3MEY1_BCL2-08      atgatt--cagagggagcat---gacacagctcttc------cgtag---
A0A3Q3MEY1_BCL2-04      atgatt--cagagggagcagtcaaaatcagctgacaagagggagtaa---
A0A3Q3MEY1_BCL2-05      atgatt--cagagggagcagtcaaaatcagctgacaagagggagtaa---
A0A3Q3MEY1_BCL2-07      atgatt--cagagggagcat---gacacagctcttc------cgtag---
A0A3Q3MEY1_BCL2-09      atgatt--cagagggagcagtcaaaatcagctgacaagagggagtaa---
A0A3Q3MEY1_BCL2-03      atgatt--cagagggagcagtcaaaatcagctgacaagagggagtaa---
A0A3Q3MEY1_BCL2-06      atgatt--cagagggagcagtcaaaatcagctgacaagagggagtaa---
A0A3Q3MX20_BCL2L1-      tggggtcgtggtgggttca-------cttattgcccagaaacgcctgtga
A0A7N8WMH7_BCL2L10      -tgggtcttgctggactcacctt---ccttctggtgcgttag--------
A0A3Q3S6A5_MCL1-01      -ttgctggtcttggggcaactctggccctgttgatcagcagaaataataa
A0A3Q3S6A5_MCL1-02      -ttgctggtcttggggcaactctggccctgttgatcagttactgtggtgt
                             *       *                                    

A0A3Q3NFM4_BCL2L1-      ----------------------------------------------
A0A3Q3MEY1_BCL2-01      ----------------------------------------------
A0A3Q3MEY1_BCL2-02      ----------------------------------------------
A0A3Q3MEY1_BCL2-10      ----------------------------------------------
A0A3Q3MEY1_BCL2-08      ----------------------------------------------
A0A3Q3MEY1_BCL2-04      ----------------------------------------------
A0A3Q3MEY1_BCL2-05      ----------------------------------------------
A0A3Q3MEY1_BCL2-07      ----------------------------------------------
A0A3Q3MEY1_BCL2-09      ----------------------------------------------
A0A3Q3MEY1_BCL2-03      ----------------------------------------------
A0A3Q3MEY1_BCL2-06      ----------------------------------------------
A0A3Q3MX20_BCL2L1-      ----------------------------------------------
A0A7N8WMH7_BCL2L10      ----------------------------------------------
A0A3Q3S6A5_MCL1-01      aatgctgacttctcaaagtgccatcagcgcgcctgtctcagcatag
A0A3Q3S6A5_MCL1-02      aatg-tga--------------------------------------
                                                                      

© 1998-2022Legal notice