Dataset for CDS BCL-2-like of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3MX20_BCL2L1-      atg-----------------------------tctcaaaacagggaac-t
A0A3Q3M6G2_MCL1-01      atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcat
A0A3Q3M6G2_MCL1-02      atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcat
                        ***                              **** * * **   * *

A0A3Q3MX20_BCL2L1-      ggtggttttctacataaaatataaactctcccagagaaact---------
A0A3Q3M6G2_MCL1-01      gatcgtcct-tccccaagatggag----tcctggagggacccgtgcacta
A0A3Q3M6G2_MCL1-02      gatcgtcct-tccccaagatggag----tcctggagggacccgtgcacta
                        * * **  * * *  ** **  *     ***  ***  **          

A0A3Q3MX20_BCL2L1-      -----------atcctctca-----tctacatagaactcaatgagcaaca
A0A3Q3M6G2_MCL1-01      cgactccagagatccctccacacagtttaccttggactc--------tcg
A0A3Q3M6G2_MCL1-02      cgactccagagatccctccacacagtttaccttggactc--------tcg
                                   ****   **     * *** * * ****         * 

A0A3Q3MX20_BCL2L1-      gaacaggactgatggg-----------ggagaggctgagtcaggtgagga
A0A3Q3M6G2_MCL1-01      caacgggaacggcgggacggctaatccgaaaagacccaagaacctggaag
A0A3Q3M6G2_MCL1-02      caacgggaacggcgggacggctaatccgaaaagacccaagaacctggaag
                         *** ***  *  ***           * * ** *  *   *  **    

A0A3Q3MX20_BCL2L1-      acag---------cggata-gcaacgcatgcca-----------------
A0A3Q3M6G2_MCL1-01      tcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggac
A0A3Q3M6G2_MCL1-02      tcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggac
                         ***         *** ** ** **  *  ***                 

A0A3Q3MX20_BCL2L1-      ----------acgggacttttaatggcac----------aagtc---ctg
A0A3Q3M6G2_MCL1-01      gacatagaggacgggtcgttaccctgcaccccggagctgcagtcggacag
A0A3Q3M6G2_MCL1-02      gacatagaggacgggtcgttaccctgcaccccggagctgcagtcggacag
                                  ***** * **     ****           ****   * *

A0A3Q3MX20_BCL2L1-      ggacccccccagcgtccccgctg-------------------cgaca---
A0A3Q3M6G2_MCL1-01      cgaagcccccagctgcccggccggggacgaggtcctggagaacgacacca
A0A3Q3M6G2_MCL1-02      cgaagcccccagctgcccggccggggacgaggtcctggagaacgacacca
                         **  ********  *** ** *                   *****   

A0A3Q3MX20_BCL2L1-      ---agaacatttg-cagtccacggcaagc----ctggatgcagtgaa---
A0A3Q3M6G2_MCL1-01      ggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccc
A0A3Q3M6G2_MCL1-02      ggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccc
                           **  *** ** ** * *  *  *  *    *****     * **   

A0A3Q3MX20_BCL2L1-      -agaggc---cctccgggactcagcc--------aacgagttt-----ga
A0A3Q3M6G2_MCL1-01      cggtggcacgactccaaagcactgtcgacaatgaaacgagttgtggaaga
A0A3Q3M6G2_MCL1-02      cggtggcacgactccaaagcactgtcgacaatgaaacgagttgtggaaga
                          * ***    ****    * * * *        ********      **

A0A3Q3MX20_BCL2L1-      gct------acgatacgcccgtgctttcagcgatctgcacaaccagctgc
A0A3Q3M6G2_MCL1-01      ccttttggaaaaatacagatacacatacaatggtatgatcaacaaactgt
A0A3Q3M6G2_MCL1-02      ccttttggaaaaatacagatacacatacaatggtatgatcaacaaactgt
                         **      *  ****       * * **  * * **  **** * *** 

A0A3Q3MX20_BCL2L1-      ---------------------atatca----cgccagccacggcctacca
A0A3Q3M6G2_MCL1-01      ccttggacgacagaggtgatgatgtgagattcgtcagc--------actg
A0A3Q3M6G2_MCL1-02      ccttggacgacagaggtgatgatgtgagattcgtcagc--------actg
                                             ** * *    ** ****        **  

A0A3Q3MX20_BCL2L1-      aagcttcgagagtgtgatggatgaagtgttccgggacggtgtcaactggg
A0A3Q3M6G2_MCL1-01      tagc--caagagcctgtttgctga-------tgggac--caccaactggg
A0A3Q3M6G2_MCL1-02      tagc--caagagcctgtttgctga-------tgggac--caccaactggg
                         ***  * ****  ** * * ***        *****     ********

A0A3Q3MX20_BCL2L1-      gtcgcatcatagggctttttgcattcggcggggctctgtgtgtcgagtgt
A0A3Q3M6G2_MCL1-01      gtcggatcgccagcctggtggccttcg--gggccgtggtgtgtc-agtac
A0A3Q3M6G2_MCL1-02      gtcggatcgccagcctggtggccttcg--gggccgtggtgtgtc-agtac
                        **** ***    * **  * ** ****  *** *   ******* ***  

A0A3Q3MX20_BCL2L1-      gtggagaagga--gatgagtccactg-gtgggcaggattgtggagtggat
A0A3Q3M6G2_MCL1-01      ctgaaggagaaaggcaggggggactgtgtggagctggtggggcaggagat
A0A3Q3M6G2_MCL1-02      ctgaaggagaaaggcaggggggactgtgtggagctggtggggcaggagat
                         ** ** ** *  *  * *   **** ****    * * * * **  ***

A0A3Q3MX20_BCL2L1-      gaccctctacctg--gacaaccacattgagccctg--gatccaaagccag
A0A3Q3M6G2_MCL1-01      ctccacctacctgctgtcagac-cagcgggactggctggtcaaaaacaa-
A0A3Q3M6G2_MCL1-02      ctccacctacctgctgtcagac-cagcgggactggctggtcaaaaacaa-
                          **  *******  * **  * **  * * *  *  * ** *** * * 

A0A3Q3MX20_BCL2L1-      ggaggatgggagcactttgctgaaatctttgggcaggatgcagcagcaga
A0A3Q3M6G2_MCL1-01      --ctcctgggatggctttgtagagttttttcg---------agtagcaga
A0A3Q3M6G2_MCL1-02      --ctcctgggatggctttgtagagttttttcg---------agtagcaga
                              *****   *****  **  * *** *         ** ******

A0A3Q3MX20_BCL2L1-      gagcaggaggtcccaagagaatttca-agaagtggctgctggcagggatg
A0A3Q3M6G2_MCL1-01      ---cccagagtccacggtgaggcacacactgatggctgttgctggtgttg
A0A3Q3M6G2_MCL1-02      ---cccagagtccacggtgaggcacacactgatggctgttgctggtgttg
                           *     ****   * **    ** *    ****** **   * * **

A0A3Q3MX20_BCL2L1-      acgct-----ggtgactggggtcgtggtgggttcacttattgcccagaaa
A0A3Q3M6G2_MCL1-01      ctggtcttggggcaactctggccctgttga--tcagcagaaataataaaa
A0A3Q3M6G2_MCL1-02      ctggtcttggggcaactctggccctgttga--tcagttactgtggtgtaa
                          * *     **  ***  ** * ** **   ***             **

A0A3Q3MX20_BCL2L1-      cgcctgtga--------------------------------------
A0A3Q3M6G2_MCL1-01      tgc---tgacttctcaaagtgccatcagcgcgcctgtctcagcatag
A0A3Q3M6G2_MCL1-02      tg----tga--------------------------------------
                         *    ***                                      

© 1998-2021Legal notice