Dataset for CDS BCL-2-like of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3MEY1_BCL2-01      atg----------------gcgaacgag-------tgtaatcgcaa----
A0A3Q3NFM4_BCL2L1-      atg----tcgtacagt-------aacag-------agagctggtgg----
A0A3Q3NFM4_BCL2L1-      atg----tcgtacagt-------aacag-------agagctggtgg----
A0A3Q3MX20_BCL2L1-      atg----tc----------tcaaaacag-------ggaactggtgg----
A0A3Q3KZW1_BCL2L10      atg----tcgtgtgggctgtggaaagag--accctggctctggcag--ag
A0A3Q3M6G2_MCL1-01      atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcat
A0A3Q3M6G2_MCL1-02      atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcat
                        ***                    *  **              *       

A0A3Q3MEY1_BCL2-01      ------cattg---------------tggaaaagtatatctgccataaac
A0A3Q3NFM4_BCL2L1-      ------agttc-----------------------tttattagctacaagc
A0A3Q3NFM4_BCL2L1-      ------agttc-----------------------tttattagctacaagc
A0A3Q3MX20_BCL2L1-      ------ttttc-----------------------tacataaaatataaac
A0A3Q3KZW1_BCL2L10      gattacctgtc-----------------------cctgtgctgcacaagc
A0A3Q3M6G2_MCL1-01      gatcgtccttccccaagatggagtcctggagggacccgtgcactacgact
A0A3Q3M6G2_MCL1-02      gatcgtccttccccaagatggagtcctggagggacccgtgcactacgact
                                 *                            *     *  *  

A0A3Q3MEY1_BCL2-01      tc--------------tccaaacgc-------------------------
A0A3Q3NFM4_BCL2L1-      tgtctcagaagaactacccgacctc-------------------------
A0A3Q3NFM4_BCL2L1-      tgtctcagaagaactacccgacctc-------------------------
A0A3Q3MX20_BCL2L1-      tctcccagagaaactatcctctcat-----ctacatagaactc------a
A0A3Q3KZW1_BCL2L10      cc------acagtcagtccctccac-----------------ctccca--
A0A3Q3M6G2_MCL1-01      cc------agag---atccctccacacagtttaccttggactctcgcaac
A0A3Q3M6G2_MCL1-02      cc------agag---atccctccacacagtttaccttggactctcgcaac
                                         **   *                           

A0A3Q3MEY1_BCL2-01      ---ggctacgtgtggg----gatttcataacg-------tccaggatgaa
A0A3Q3NFM4_BCL2L1-      ------------tctg--ctgaggccagaagatgctggtggaaggacaga
A0A3Q3NFM4_BCL2L1-      ------------tctg--ctgaggccagaagatgctggtggaaggacaga
A0A3Q3MX20_BCL2L1-      atgagcaacagaacaggactgatg-ggggaga-----ggctgagtcaggt
A0A3Q3KZW1_BCL2L10      -------gcgagtcag--ctgctgccatgagatgtctggcccagaaaatg
A0A3Q3M6G2_MCL1-01      gggaacggcgggacgg--ctaatccgaaaaga-------cccaagaacct
A0A3Q3M6G2_MCL1-02      gggaacggcgggacgg--ctaatccgaaaaga-------cccaagaacct
                                       *             *            *       

A0A3Q3MEY1_BCL2-01      gat----------------gctgctaataatggctctgtagttgcccctc
A0A3Q3NFM4_BCL2L1-      gggagacatgaccggtgcagctgccaccaacgg---------------ct
A0A3Q3NFM4_BCL2L1-      gggagacatgaccggtgcagctgccaccaacgg---------------ct
A0A3Q3MX20_BCL2L1-      gagga-----------acagcggatagcaacgcatgc-caacgggacttt
A0A3Q3KZW1_BCL2L10      gagag-----------gcagc-accaggctcgcttccac-------tccc
A0A3Q3M6G2_MCL1-01      ggaag-----------tcagc-tccacaaacgggtacgcgacaaaatcca
A0A3Q3M6G2_MCL1-02      ggaag-----------tcagc-tccacaaacgggtacgcgacaaaatcca
                        *                  **    *     *                  

A0A3Q3MEY1_BCL2-01      cgccg----actgtggtc--------------------------------
A0A3Q3NFM4_BCL2L1-      tgctggtcaacagcaggt--------------------------------
A0A3Q3NFM4_BCL2L1-      tgctggtcaacagcaggt--------------------------------
A0A3Q3MX20_BCL2L1-      taatg----gca-caagt----------------------cctg------
A0A3Q3KZW1_BCL2L10      tc-------act-cagac-------------------tttcctgaa----
A0A3Q3M6G2_MCL1-01      tcgtggccgaca-cggacgacatagaggacgggtcgttaccctgcacccc
A0A3Q3M6G2_MCL1-02      tcgtggccgaca-cggacgacatagaggacgggtcgttaccctgcacccc

A0A3Q3MEY1_BCL2-01      --------cgccggtgccgtgacgcgagcaccgggcccgac---------
A0A3Q3NFM4_BCL2L1-      ------------------------atgtcagcgg-ccggcc---------
A0A3Q3NFM4_BCL2L1-      ------------------------atgtcagcgg-ccggcc---------
A0A3Q3MX20_BCL2L1-      -------------ggacc------cccccagcgtccccgct---------
A0A3Q3KZW1_BCL2L10      ------gcagtgcgggccg----gacccctgct--ccagcc---------
A0A3Q3M6G2_MCL1-01      ggagctgcagt-cggacagcgaagcccccagctgcccggccggggacgag
A0A3Q3M6G2_MCL1-02      ggagctgcagt-cggacagcgaagcccccagctgcccggccggggacgag
                                                    *  *   ** *           

A0A3Q3MEY1_BCL2-01      ------------------agcgagagcatcccccagctctgcagag--gg
A0A3Q3NFM4_BCL2L1-      ------------------ggggatgtcatcatcc--ccacatggaggcg-
A0A3Q3NFM4_BCL2L1-      ------------------ggggatgtcatcatcc--ccacatggaggcg-
A0A3Q3MX20_BCL2L1-      ----------------gcgacaagaacatttgcagtccacggcaag----
A0A3Q3KZW1_BCL2L10      ----------------tcaggaaggttat-------------agaggag-
A0A3Q3M6G2_MCL1-01      gtcctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgt
A0A3Q3M6G2_MCL1-02      gtcctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgt
                                              *    **               **    

A0A3Q3MEY1_BCL2-01      ctccctcagtccgacccacaagccgccattcacagagtcctgcgcgaggc
A0A3Q3NFM4_BCL2L1-      -------------------tagaggct--gtaaaggcagctcttagggac
A0A3Q3NFM4_BCL2L1-      -------------------tagaggct--gtaaaggcagctcttagggac
A0A3Q3MX20_BCL2L1-      -----------------cctggatgca--gtgaaagaggccctccgggac
A0A3Q3KZW1_BCL2L10      ------------------ctggtggca--------------gatggacac
A0A3Q3M6G2_MCL1-01      ttctggactttctaaaccccggtggcacgactccaaagcactgtcgacaa
A0A3Q3M6G2_MCL1-02      ttctggactttctaaaccccggtggcacgactccaaagcactgtcgacaa
                                             *  **                   *    

A0A3Q3MEY1_BCL2-01      tgga----------gatgaacttgaaagactgtatcagccggactttacg
A0A3Q3NFM4_BCL2L1-      tccgct--------gaagagtttgaactgctcttcactcaggcgtttagt
A0A3Q3NFM4_BCL2L1-      tccgct--------gaagagtttgaactgctcttcactcaggcgtttagt
A0A3Q3MX20_BCL2L1-      tcagcc--------aacgagtttgagctacgatacgcccgtgctttcagc
A0A3Q3KZW1_BCL2L10      ttgaac----tgggggagggttgtt-------tcccttttcacctttact
A0A3Q3M6G2_MCL1-01      tgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaat
A0A3Q3M6G2_MCL1-02      tgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaat
                        *                *   *          *           *  *  

A0A3Q3MEY1_BCL2-01      gagatgtcgcgacagctgtat----------------ctcacctcca---
A0A3Q3NFM4_BCL2L1-      gacctttcctcacagcttgac----------------atcactcctgac-
A0A3Q3NFM4_BCL2L1-      gacctttcctcacagcttgac----------------atcactcctgac-
A0A3Q3MX20_BCL2L1-      gatctgcacaaccagctgcat----------------atcacgccag---
A0A3Q3KZW1_BCL2L10      ggggtg---------ctgtcc-------agacagctgatggagcagaag-
A0A3Q3M6G2_MCL1-01      ggtatgatcaacaaactgtccttggacgacagaggtgatgatgtgagatt
A0A3Q3M6G2_MCL1-02      ggtatgatcaacaaactgtccttggacgacagaggtgatgatgtgagatt
                        *   *          **                     *           

A0A3Q3MEY1_BCL2-01      ccacggcgcagaggcgattcgccgaggtgatagatgaactgttccgggac
A0A3Q3NFM4_BCL2L1-      --acagcttaccacagctttaaaagcgtgatggatgaggtgttcaaggat
A0A3Q3NFM4_BCL2L1-      --acagcttaccacagctttaaaagcgtgatggatgaggtgttcaaggat
A0A3Q3MX20_BCL2L1-      ccacggcctaccaaagcttcgagagtgtgatggatgaagtgttccgggac
A0A3Q3KZW1_BCL2L10      ----ggc--a-tgaagc--c-agggctggactctggaaagg---------
A0A3Q3M6G2_MCL1-01      cgtcagc--actgtagc--caagagcctgtttgctgatggg---------
A0A3Q3M6G2_MCL1-02      cgtcagc--actgtagc--caagagcctgtttgctgatggg---------
                             **  *     *            *      **   *         

A0A3Q3MEY1_BCL2-01      ggggtgaactggggccggattatcgctttcttcgagttcggcggcaccgt
A0A3Q3NFM4_BCL2L1-      ggagtcaactggggacgcatagtgggcctgtttgctttcggtggtgtact
A0A3Q3NFM4_BCL2L1-      ggagtcaactggggacgcatagtgggcctgtttgctttcggtggtgtact
A0A3Q3MX20_BCL2L1-      ggtgtcaactggggtcgcatcatagggctttttgcattcggcggggctct
A0A3Q3KZW1_BCL2L10      ggcaggaattgggacagg--------------ggcctgag--ag------
A0A3Q3M6G2_MCL1-01      accaccaactggggtcggatcgccagcctggtggccttcg--gggccgtg
A0A3Q3M6G2_MCL1-02      accaccaactggggtcggatcgccagcctggtggccttcg--gggccgtg
                              ** ****   *                *  *  *   *      

A0A3Q3MEY1_BCL2-01      gtgcgtggagtgcgcggccaaggaggagatgacatcgcaagtggacaaca
A0A3Q3NFM4_BCL2L1-      gtgtgtggaatgcattg---agaagaacatgagtgcgctggtgtcccgca
A0A3Q3NFM4_BCL2L1-      gtgtgtggaatgcattg---agaagaacatgagtgcgctggtgtcccgca
A0A3Q3MX20_BCL2L1-      gtgtgtcgagtgtgtgg---agaaggagatgagtccactggtgggcagga
A0A3Q3KZW1_BCL2L10      -------------ctgc---agggg-----------actggca---gaga
A0A3Q3M6G2_MCL1-01      gtgtgtc-agtacctga---aggag-----------aaaggcagggggga
A0A3Q3M6G2_MCL1-02      gtgtgtc-agtacctga---aggag-----------aaaggcagggggga
                                            **  *               *        *

A0A3Q3MEY1_BCL2-01      tcgc-------------------ggagtggatgacggagtatttaaatgg
A0A3Q3NFM4_BCL2L1-      tcgc-------------------agattggatgaccatgtatctggatga
A0A3Q3NFM4_BCL2L1-      tcgc-------------------agattggatgaccatgtatctggatga
A0A3Q3MX20_BCL2L1-      ttgt-------------------ggagtggatgaccctctacctggacaa
A0A3Q3KZW1_BCL2L10      ccat----agctgattacctgggagaggaga-------------------
A0A3Q3M6G2_MCL1-01      ctgtgtggagctgg-----tggggcaggagatctccacctacctgctgtc
A0A3Q3M6G2_MCL1-02      ctgtgtggagctgg-----tggggcaggagatctccacctacctgctgtc
                                                 *   **                   

A0A3Q3MEY1_BCL2-01      acctcttaacagctggatacaagataacgggggatgggatgcctttgtgg
A0A3Q3NFM4_BCL2L1-      gcacatcagtccgtggatcgagagccaaggaggctgggactgctttgctg
A0A3Q3NFM4_BCL2L1-      gcacatcagtccgtggatcgagagccaaggaggctgggactgctttgctg
A0A3Q3MX20_BCL2L1-      ccacattgagccctggatccaaagccagggaggatgggagcactttgctg
A0A3Q3KZW1_BCL2L10      -----agaaagactggctgcaagagaatgacggatgggaagggttctgca
A0A3Q3M6G2_MCL1-01      agaccagcgggactggctggtcaaaaacaactcctgggatggctttgtag
A0A3Q3M6G2_MCL1-02      agaccagcgggactggctggtcaaaaacaactcctgggatggctttgtag
                                     *** *        *       *****    **     

A0A3Q3MEY1_BCL2-01      agatgtatgacaggcagagggagtctgtcttcagttgttcctggccctcc
A0A3Q3NFM4_BCL2L1-      agatttttgggcgagatgcagctgcagaagcaaggagatcacaggaaacc
A0A3Q3NFM4_BCL2L1-      agatttttgggcgagatgcagctgcagaagcaaggagatcacaggaaacc
A0A3Q3MX20_BCL2L1-      aaatctttgggcaggatgcagcagcagagagcaggaggtcccaagagaat
A0A3Q3KZW1_BCL2L10      agttctcccacagcgccagagaggtcag------------ccacgactca
A0A3Q3M6G2_MCL1-01      agttttttc---------gagtagcaga------------cccagagtcc
A0A3Q3M6G2_MCL1-02      agttttttc---------gagtagcaga------------cccagagtcc
                        *  * *              *                             

A0A3Q3MEY1_BCL2-01      atca--aaacagtcttcggcctggctgcacttggggcagctagcattact
A0A3Q3NFM4_BCL2L1-      ctgaggaggtggctgctagttggagtggcgctgctaacgggagtgctgat
A0A3Q3NFM4_BCL2L1-      ctgaggaggtggctgctagttggagtggcgctgctaacgggagtgctgat
A0A3Q3MX20_BCL2L1-      ttcaagaagtggctgctggcagggatgacgctggtgactggggtcgtggt
A0A3Q3KZW1_BCL2L10      tccatgaagacagcgctgtt--tgctgctgctggag---tgggtcttgct
A0A3Q3M6G2_MCL1-01      acggtgaggcacacactgat--ggctgttgctggtg---ttgctggtctt
A0A3Q3M6G2_MCL1-02      acggtgaggcacacactgat--ggctgttgctggtg---ttgctggtctt
                              *                  **    **             *  *

A0A3Q3MEY1_BCL2-01      atcggagca-------taccttacacagaagtga----------------
A0A3Q3NFM4_BCL2L1-      a--ggtgtg-------ctcatcgctaagaaacagtga-------------
A0A3Q3NFM4_BCL2L1-      a--ggtgtg-------ctcatcgctaagaaacagtga-------------
A0A3Q3MX20_BCL2L1-      g--ggttca-------cttattgcccagaaacgcctgtga----------
A0A3Q3KZW1_BCL2L10      g--gactcacctt---ccttctggtgcgttag------------------
A0A3Q3M6G2_MCL1-01      g--gggcaactctggccctgttgatcagcagaaataataaaatgctgact
A0A3Q3M6G2_MCL1-02      g--gggcaactctggccctgttgatcagttactgtggtgtaatg-tga--
                           *                       *                      

A0A3Q3MEY1_BCL2-01      ------------------------------------
A0A3Q3NFM4_BCL2L1-      ------------------------------------
A0A3Q3NFM4_BCL2L1-      ------------------------------------
A0A3Q3MX20_BCL2L1-      ------------------------------------
A0A3Q3KZW1_BCL2L10      ------------------------------------
A0A3Q3M6G2_MCL1-01      tctcaaagtgccatcagcgcgcctgtctcagcatag
A0A3Q3M6G2_MCL1-02      ------------------------------------

© 1998-2020Legal notice