Dataset for CDS BAX-like of Organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q8SQ43_BAX-01           atggacgggtccggggagcagcccagaggcggggggcacaccagctctga
A0A337SCA9_BAX-01       atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A337SCA9_BAX-02       atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2I2UCZ8_BAK1-02      atggc--atccgggcaagg--cccag-------------gtcctcccagg
A0A2I2UCZ8_BAK1-01      atggc--atccgggcaagg--cccag-------------gtcctcccagg
A0A2I2UCZ8_BAK1-03      atggc--atccgggcaagg--cccag-------------gtcctcccagg
A0A5F5XSW5_BOK-01       atgga--ggtgctgcggcgctcctcg-------------gtcttcgccgc
A0A5F5XSW5_BOK-02       atgga--ggtgctgcggcgctcctcg-------------gtcttcgccgc
                        ****         *       **  *               *  * * * 

Q8SQ43_BAX-01           gcagatcatgaa-gacaggggcccttttgcttc-----agggtttcat--
A0A337SCA9_BAX-01       gcagatcatgaa-gacaggggcccttttgcttc-----agggtttcat--
A0A337SCA9_BAX-02       gcagatcatgaa-gacaggggcccttttgcttc-----agg---------
A0A2I2UCZ8_BAK1-02      caggagtgtgaa-gagactgccccgtctgctacttctgaggagcaggtag
A0A2I2UCZ8_BAK1-01      caggagtgtgaa-gagactgccccgtctgctacttctgaggagcaggtag
A0A2I2UCZ8_BAK1-03      caggagtgtgaa-gagactgccccgtctgctacttctgaggagcaggtag
A0A5F5XSW5_BOK-01       cgagatcatggacgcctttgaccgctcgcccaccgacaaggagctggtgg
A0A5F5XSW5_BOK-02       cgagatcatggacgcctttgaccgctcgcccaccgacaaggagctggtgg
                           **   ** * *     * **  *   *  *     ***         

Q8SQ43_BAX-01           ccaagatcgagcagggcgaatggggg-----------gagagacgcccga
A0A337SCA9_BAX-01       ccaagatcgagcagggcgaatggggg-----------gagagacgcccga
A0A337SCA9_BAX-02       --------------------------------------------------
A0A2I2UCZ8_BAK1-02      cccgggacaccgag-------gaggttttccgca---gcta-tgtttttc
A0A2I2UCZ8_BAK1-01      cccgggacaccgag-------gaggttttccgca---gcta-tgtttttc
A0A2I2UCZ8_BAK1-03      cccgggacaccgag-------gaggttttccgca---gcta-tgtttttc
A0A5F5XSW5_BOK-01       cccaggccaaggcgctcggccgggagttcgtgcatgcgcgactgctgcgc
A0A5F5XSW5_BOK-02       cccaggccaaggcgctcggccgggagttcgtgcatgcgcgactgctgcgc
                                                                          

Q8SQ43_BAX-01           gctggccctggagcaggtgccccaggacgcgtc-------caccaagaag
A0A337SCA9_BAX-01       gctggccctggagcaggtgccccaggacgcgtc-------caccaagaag
A0A337SCA9_BAX-02       --------------------------------------------------
A0A2I2UCZ8_BAK1-02      accgttatcagcaggagca--------------------------ggagg
A0A2I2UCZ8_BAK1-01      accgttatcagcaggagca--------------------------ggagg
A0A2I2UCZ8_BAK1-03      accgttatcagcaggagca--------------------------ggagg
A0A5F5XSW5_BOK-01       gccggcctcgcctggaacgcgcccgaacgcgccgctcccgcccccggagg
A0A5F5XSW5_BOK-02       gccggcctcgcctggaacgcgcccgaacgcgccgctcccgcccccggagg
                                                                          

Q8SQ43_BAX-01           ctg-------------agcgagtgtctcaagcgcatcggagatgaactgg
A0A337SCA9_BAX-01       ctg-------------agcgagtgtctcaagcgcatcggagatgaactgg
A0A337SCA9_BAX-02       --------------------------------------------------
A0A2I2UCZ8_BAK1-02      ctg----------------agggggcagctgcgcct----actgacccag
A0A2I2UCZ8_BAK1-01      ctg----------------agggggcagctgcgcct----actgacccag
A0A2I2UCZ8_BAK1-03      ctg----------------agggggcagctgcgcct----actgacccag
A0A5F5XSW5_BOK-01       ccgcctggcggaggtgtgcgcggtgctgctgcgcctgggagatgagctgg
A0A5F5XSW5_BOK-02       ccgcctggcggaggtgtgcgcggtgctgctgcgcctgggagatgagctgg
                                                                          

Q8SQ43_BAX-01           ac-----------------agtaac-------------------atggaa
A0A337SCA9_BAX-01       ac-----------------agtaac-------------------atggaa
A0A337SCA9_BAX-02       --------------------------------------------------
A0A2I2UCZ8_BAK1-02      aaatagtcaccttgcccctagaacctagcagcaccatggggcaggtgggt
A0A2I2UCZ8_BAK1-01      aaatagtcaccttgcccctagaacctagcagcaccatggggcaggtgggt
A0A2I2UCZ8_BAK1-03      aaatagtcaccttgcccctagaacctagcagcaccatggggcaggtgggt
A0A5F5XSW5_BOK-01       agctg---atccggccc--agcatctaccgcaac----------gtggct
A0A5F5XSW5_BOK-02       agctg---atccggccc--agcatctaccgcaac----------gtggct
                                                                          

Q8SQ43_BAX-01           ttgcagaggatgatc-----gcagctgtggacacagactccccccgcgag
A0A337SCA9_BAX-01       ttgcagaggatgatc-----gcagctgtggacacagactccccccgcgag
A0A337SCA9_BAX-02       -------ggatgatc-----gcagctgtggacacagactccccccgcgag
A0A2I2UCZ8_BAK1-02      cggcagctcgccatc--------attggggacaacatcaaccagcgctac
A0A2I2UCZ8_BAK1-01      cggcagctcgccatc--------attggggacaacatcaaccagcgctac
A0A2I2UCZ8_BAK1-03      cggcagctcgccatc--------attggggacaacatcaaccagcgctac
A0A5F5XSW5_BOK-01       cgtcagctgaacatctccctgcagtctgagacagtggtgaccgacgcc--
A0A5F5XSW5_BOK-02       cgtcagctgaacatctccctgcagtctgagacagtggtgaccgacgcc--
                                    ***              ****       **  ***   

Q8SQ43_BAX-01           g--------tctttttccgagtggcagcggagatgttttccg--------
A0A337SCA9_BAX-01       g--------tctttttccgagtggcagcggagatgttttccg--------
A0A337SCA9_BAX-02       g--------tctttttccgagtggcagcggagatgttttccg--------
A0A2I2UCZ8_BAK1-02      gattcagagttccaggccatgctgcagcgc---------ctgcaacccac
A0A2I2UCZ8_BAK1-01      gattcagagttccaggccatgctgcagcgc---------ctgcaacccac
A0A2I2UCZ8_BAK1-03      gattcagagttccaggccatgctgcagcgc---------ctgcaacccac
A0A5F5XSW5_BOK-01       ---------ttcctggccgtg--gcagcacaaatcttctccgcaggcatc
A0A5F5XSW5_BOK-02       ---------ttcctggccgtg--gcagcacaaatcttctccgcaggta--
                                 *      **  *  *****           * *        

Q8SQ43_BAX-01           -----------------------------atggcaacttca---------
A0A337SCA9_BAX-01       -----------------------------atggcaacttca---------
A0A337SCA9_BAX-02       -----------------------------atggcaacttca---------
A0A2I2UCZ8_BAK1-02      a-gcagagaacgcctatgaacttttcaccaagattgcctcg---------
A0A2I2UCZ8_BAK1-01      a-gcagagaacgcctatgaacttttcaccaagattgcctcg---------
A0A2I2UCZ8_BAK1-03      a-gcagagaacgcctatgaacttttcaccaagattgcctcgaggccagca
A0A5F5XSW5_BOK-01       acgtggggcaaggtggtgtccctgtactca--gtggctgcggggct----
A0A5F5XSW5_BOK-02       ------ggcctg--ggtaccccctcccccagggcgcccacagggctgggg
                                                     *      *  *          

Q8SQ43_BAX-01           -----------------------------------actggggccgggtcg
A0A337SCA9_BAX-01       -----------------------------------actggggccgggtcg
A0A337SCA9_BAX-02       -----------------------------------actggggccgggtcg
A0A2I2UCZ8_BAK1-02      -----------agtctatttgagagcggcatca--actggggccgagtgg
A0A2I2UCZ8_BAK1-01      -----------agtctatttgagagcggcatca--actggggccgagtgg
A0A2I2UCZ8_BAK1-03      gcaacacccacagtctatttgagagcggcatca--actggggccgagtgg
A0A5F5XSW5_BOK-01       ------------ggccgtag---------------actgtgtgcggcagg
A0A5F5XSW5_BOK-02       t----------gggccggggggcagggccttcagcactggggcctgcagg
                                                           **** *  *     *

Q8SQ43_BAX-01           ---ttgccctcttctactttgccagcaaactggtgctc------------
A0A337SCA9_BAX-01       ---ttgccctcttctactttgccagcaaactggtgctc------------
A0A337SCA9_BAX-02       ---ttgccctcttctactttgccagcaaactggtgctc------------
A0A2I2UCZ8_BAK1-02      ---tggctctcctgggctttg---gctaccgcctggct------------
A0A2I2UCZ8_BAK1-01      ---tggctctcctgggctttg---gctaccgcctggct------------
A0A2I2UCZ8_BAK1-03      ---tggctctcctgggctttg---gctaccgcctggct------------
A0A5F5XSW5_BOK-01       ----------cccagccc------gcca-----tggtc------------
A0A5F5XSW5_BOK-02       aagcggcccccacagccctgg--agccacctggtggtcacgtgtactttc
                                  *     *       ** *     **               

Q8SQ43_BAX-01           ------------------------aaggccctgtgtaccaaggtgcccga
A0A337SCA9_BAX-01       ------------------------aaggccctgtgtaccaaggtgcccga
A0A337SCA9_BAX-02       ------------------------aaggccctgtgtaccaaggtgcccga
A0A2I2UCZ8_BAK1-02      ------------------------------ctacacatctaccagcacgg
A0A2I2UCZ8_BAK1-01      ------------------------------ctacacatctaccagcacgg
A0A2I2UCZ8_BAK1-03      ------------------------------ctacacatctaccagcacgg
A0A5F5XSW5_BOK-01       ---------------------------------cacgctatcgtcgactg
A0A5F5XSW5_BOK-02       ttgctgcacaaaagagcccagaaccttgactcgaacggtgacgtgcagtg
                                                                          

Q8SQ43_BAX-01           gctgatccgg----------------------------------------
A0A337SCA9_BAX-01       gctgatccgg----------------------------------------
A0A337SCA9_BAX-02       gctgatccgg----------------------------------------
A0A2I2UCZ8_BAK1-02      cctgaccggcttcctgggccaggtgaccaaactggtggtcgacgtcatgc
A0A2I2UCZ8_BAK1-01      cctgaccggcttcctgggccaggtgaccaaactggtggtcgacgtcatgc
A0A2I2UCZ8_BAK1-03      cctga---------------------------------------------
A0A5F5XSW5_BOK-01       cctc----------------------------ggggagtttgtgc-----
A0A5F5XSW5_BOK-02       cctcccccggttgtgaggacggtgggcctgctgggcagctggtgccaggc
                         **                                               

Q8SQ43_BAX-01           -accatcatgggctggacactggacttccttcgagagcggctgc------
A0A337SCA9_BAX-01       -accatcatgggctggacactggacttccttcgagagcggctgc------
A0A337SCA9_BAX-02       -accatcatgggctggacactggacttccttcgagagcggctgc------
A0A2I2UCZ8_BAK1-02      tgcgtcactgcattgcccggtggattgcgcagaggggcggctg-------
A0A2I2UCZ8_BAK1-01      tgcgtcactgcattgcccggtggattgcgcagaggggcggctgggtaagt
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
A0A5F5XSW5_BOK-01       ----gcaagaccctggc----gccctggctgcggaggc-gcggc------
A0A5F5XSW5_BOK-02       ctctacgaggctctgactgg-gcatcggctggggtggcagcgacctgaag
                                                                          

Q8SQ43_BAX-01           -------tgggctggatcc-------------------------------
A0A337SCA9_BAX-01       -------tgggctggatcc-------------------------------
A0A337SCA9_BAX-02       -------tgggctggatcc-------------------------------
A0A2I2UCZ8_BAK1-02      --------------------------------------------------
A0A2I2UCZ8_BAK1-01      gcccaagcgtcggcagcctcc-----------------------------
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
A0A5F5XSW5_BOK-01       ----ggatggaccg-atgtcc-----------------------------
A0A5F5XSW5_BOK-02       tcttgtctgggccgcgtgtcccagattgccagtcggtgctggccgttgac
                                                                          

Q8SQ43_BAX-01           --------------------------------------------------
A0A337SCA9_BAX-01       --------------------------------------------------
A0A337SCA9_BAX-02       --------------------------------------------------
A0A2I2UCZ8_BAK1-02      --------------------------------------------------
A0A2I2UCZ8_BAK1-01      -------------------tccccgctgctggggctgcctctctcccagc
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
A0A5F5XSW5_BOK-01       -------------------tcaagtgtgtggtc-----------------
A0A5F5XSW5_BOK-02       ttagagggggggcagcgtgtcctgcgtgtggcctgtgggcttctcacggc
                                                                          

Q8SQ43_BAX-01           --aggaccagg---------gtggttgggacggcctcctctcctactttg
A0A337SCA9_BAX-01       --aggaccagg---------gtggttgggacggcctcctctcctactttg
A0A337SCA9_BAX-02       --aggaccagg---------gtggttgggacggcctcctctcctactttg
A0A2I2UCZ8_BAK1-02      --------------------------------------------------
A0A2I2UCZ8_BAK1-01      cccaccccggccctggagtgcctgtatgtgccgtcagcccctctatctct
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
A0A5F5XSW5_BOK-01       --agcaccgag-----------------cccggcttcc--gctcacactg
A0A5F5XSW5_BOK-02       gtggtaccgggtccccaaggggagtgtccccagcatcccaggtgggactg
                                                                          

Q8SQ43_BAX-01           g--gacacccacgtggcagacagtgaccatctttgtggcggg--------
A0A337SCA9_BAX-01       g--gacacccacgtggcagacagtgaccatctttgtggccgg--------
A0A337SCA9_BAX-02       g--gacacccacgtggcagacagtgaccatctttgtggccgg--------
A0A2I2UCZ8_BAK1-02      -----------ggtggcagccctgaacttgggaaatggccccatcgtg--
A0A2I2UCZ8_BAK1-01      gtctcttggcaggtggcagccctgaacttgggaaatggccccatcgtg--
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
A0A5F5XSW5_BOK-01       gctggt-----ggccgca--ct----ctgcagcttcggccgcttcctg--
A0A5F5XSW5_BOK-02       ccaggctctcgggatgcagcct----cttcaggtacggtgtcactctgcc
                                                                          

Q8SQ43_BAX-01           --------------agtgctgact--------------------------
A0A337SCA9_BAX-01       --------------agtgctgact--------------------------
A0A337SCA9_BAX-02       --------------agtgctgact--------------------------
A0A2I2UCZ8_BAK1-02      --aacgtgctgat-agttctgtct--------------------------
A0A2I2UCZ8_BAK1-01      --aacgtgctgat-agttctgtct--------------------------
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
A0A5F5XSW5_BOK-01       --------------aaggccgcct--------------------------
A0A5F5XSW5_BOK-02       ggatcgtgttggtcaaaggcgccttgcagggcggtcccacgtggagggaa
                                                                          

Q8SQ43_BAX-01           ---------------------------------gcgtcactcgccatctg
A0A337SCA9_BAX-01       ---------------------------------gcgtcactcaccatctg
A0A337SCA9_BAX-02       ---------------------------------gcgtcactcaccatctg
A0A2I2UCZ8_BAK1-02      ---------------------------gtggttctgttgggccagtttgt
A0A2I2UCZ8_BAK1-01      ---------------------------gtggttctgttgggccagtttgt
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
A0A5F5XSW5_BOK-01       ---------------------------------tcttcgtgctgttgcca
A0A5F5XSW5_BOK-02       gatccatgagggcaggagccccggagcagaggctccctgggcagtctctg
                                                                          

Q8SQ43_BAX-01           gaaaaagatgg-----------------gctga
A0A337SCA9_BAX-01       gaaaaagatgg-----------------gctga
A0A337SCA9_BAX-02       gaaaaagatgg-----------------gctga
A0A2I2UCZ8_BAK1-02      ggtacgaagattcttcaaat--------catga
A0A2I2UCZ8_BAK1-01      ggtacgaagattcttcaaat--------catga
A0A2I2UCZ8_BAK1-03      ---------------------------------
A0A5F5XSW5_BOK-01       gaga------------------------gatga
A0A5F5XSW5_BOK-02       gggaagagcaccacacctgtctcagctggctga
                                                         

© 1998-2023Legal notice