Dataset for CDS Unclassified of Organism Eptatretus burgeri

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A8C4Q5W8_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Eptatretus burgeri (length=522 residues).
atgtttaattgtgatgggtatgcctacgtggtgcaccgtgtggcaccggacgtgctgcaaaaccccttcagccaagcaga
agcgattctcatccagctctgtgacgaggtgttttccaaataccgtgaggcctacggggaaatggtggcacggctggacc
cgaactgccgcggtttgagtaacccgagttcggtggcaggaacggtgacccgtgtggccgaagtgttgttctccgatggt
caggtgaactggggacgcctcgtcaccctcatagtcctgttggccacggtcgctcaggaaatagacgaccaattcgggac
ggtggatgaacgagctgaggtgttgtcccttgagatgagccaattcgtgatggagcaccttggggactggattcgagaac
gaggcggttgggtgagtcctcgagccggtgttgcctgtgccgaacttgccggcgttataacctctgagacggcggagctg
ttaagtgacgccgaatcttcaatatttggctgtcaagattag
>gnl|bcl2dbcds|A0A8C4QT86_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Eptatretus burgeri (length=639 residues).
atggagttccttcgtcacagagctctggtgctcaggggtttgtggacgctacccaatgacgtgcagctcgttgcccaggc
caagaccctctgtggagactgtattaaatggcgattatctcggactggcacgaccttcaatgcttcctcacaatcctctg
cacccagctacaaaagctcaaggattcttgcagaagcctcctgtgtcctgctcctgtttgctcaagagcttgaagccatg
ttccctgatctgtttcacaacgttgatcggaaactgcaaatactggccctcgctgagctggaagtgtctgaagcgctgca
tgcgtttgcaacacttcttttctatgaacaacaagtgacgtggggccgggttgtggcattgttcatggttgcagccaacc
tggctgaagtttgtgttgctcacggatgccctgctctcatccacaccattgtcgactgcattggtgtgatcttcctcaag
actgtgctaccatgggtgaaggcccagggaggatggtcggacatggttcgaacactggactgcaggaaaagacccattgg
cctttgttggctcctgggttccttggcaactattctgggcttaattgtcctcccccactgtgcagagaagatgtactga
>gnl|bcl2dbcds|A0A8C4QT86_uncBOK-02 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Eptatretus burgeri (length=639 residues).
atggagttccttcgtcacagagctctggtgctcaggggtttgtggacgctacccaatgacgtgcagctcgttgcccaggc
caagaccctctgtggagactgtattaaatggcgattatctcggactggcacgaccttcaatgcttcctcacaatcctctg
cacccagctacaaaagctcaaggattcttgcagaagcctcctgtgtcctgctcctgtttgctcaagagcttgaagccatg
ttccctgatctgtttcacaacgttgatcggaaactgcaaatactggccctcgctgagctggaagtgtctgaagcgctgca
tgcgtttgcaacacttcttttctatgaacaacaagtgacgtggggccgggttgtggcattgttcatggttgcagccaacc
tggctgaagtttgtgttgctcacggatgccctgctctcatccacaccattgtcgactgcattggtgtgatcttcctcaag
actgtgctaccatgggtgaaggcccagggaggatggtcggacatggttcgaacactggactgcaggaaaagacccattgg
cctttgttggctcctgggttccttggcaactattctgggcttaattgtcctcccccactgtgcagagaagatgtactga
>gnl|bcl2dbcds|A0A8C4QT86_uncBOK-03 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Eptatretus burgeri (length=516 residues).
atggagttccttcgtcacagagctctggtgctcaggggtttgtggacgctacccaatgacgtgcagctcgttgcccaggc
caagaccctctgtggagactgtattaaatggcgattatctcggactggcacgaccttcaatgcttcctcacaatcctctg
cacccagctacaaaagctcaaggattcttgcagaagcctcctgtgtcctgctcctgtttgctcaagagcttgaagccatg
ttccctgatctgtttcacaacgttgatcggaaactgcaaatactggccctcgctgagctggaagtgtctgaagcgctgca
tgcgtttgcaacacttcttttctatgaacaactcggacatggttcgaacactggactgcaggaaaagacccattggcctt
tgttggctcctgggttccttggcaactattctgggcttaattgtcctcccccactgtgcagagaagatgtactgagcttg
gccatttttcaaaatggcatttcctggaagtgttga
>gnl|bcl2dbcds|A0A8C4QZD2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Eptatretus burgeri (length=777 residues).
atgtatcgtcttgtgaattttactgggactttcaaaaaagtgcagggaaggaaaagaaattccgatgaaatgacaagtga
ggtgttaaatacggaacgcgccaagaaagctcatttggacctgtcaggaggacaatgtggagatactggtgatgggagtg
cgcatagacctgatggacacaacaccactcaaccacgacggatccacggacgacaccgggacggcccaccaaaggactct
gtgggagaatggatcagccaacatgctggaacaatgttgcgcaggttcattttgcagcaagcatcattcaacggcattga
gaagcagcccacccttcaggacctgggtggcaagtctgaagagagtaatgagaccatcacgagaatcgttgataaattat
ttgctgcagcacagaagctggatgctgatgagatgctacagcaggagatcaatcaaattcctttgcgtatgagttacaag
ttgttcatgactgtcgtcaaacaagttttcttgagaggaatgagttggggttgtgtagcaacactcttctactttgcata
taaactgataatgagggtgttcaccggtggactgatggacttcatccctacactcatgatgtgggtgcaggaggcgatcc
ttttttacattgcgccttggatctccaagcagggtggatgggtcttcctgttgaattacatctttggagaaactgcaccg
gaccctggacctaagactctaccgaaaagaatactttcttttatgaaacttctttga
>gnl|bcl2dbcds|A0A8C4QZD2_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Eptatretus burgeri (length=618 residues).
atgtatcgtcttgtgaattttactgggactttcaaaaaagtgcagggaaggaaaagaaattccgatgaaatgacaagtga
ggtgttaaatacggaacgcgccaagaaagctcatttggacctgtcaggaggacaatgtggagatactggtgatgggagtg
cgcatagacctgatggacacaacaccactcaaccacgacggatccacggacgacaccgggacggcccaccaaaggactct
gtgggagaatggatcagccaacatgctggaacaatgttgcgcaggttcattttgcagcaagcatcattcaacggcattga
gaagcagcccacccttcaggacctgggtggcaagtctgaagagagtaatgagaccatcacgagaatcgttgataaattat
ttgctgcagcacagaagctggatgctgatgagatgctacagcaggagatcaatcaaattcctttgcgtatgagttacaag
ttgttcatgactgtcgtcaaacaagttttcttgagaggaatgagttggggttgtgtagcaacactcttctactttgcata
taaactgataatgagggtaagtgaactcatgctcatgcataccacattcgtgttctga
>gnl|bcl2dbcds|A0A8C4WVW0_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Eptatretus burgeri (length=798 residues).
atgaaagacgcagaatgtcaaaccgagagagcaatcaccgacgtgaccacgaactccactaaagagggattcattggctt
catcacggaagtagtaaattgtacagctcaagcatggagcagatccgaaaaaataaatatcatctcccctgtaaccttta
aacatctgggctgggaggagttcactttcaaggtgatcaacaaaatattcaaccaatcgatccacgcgcagcagagttcc
tttctttccgcgaccctgtcggtgaccaaggcctacatgatccaccacgtctaccccgacaagcagcgggtccacacccc
cgaagcggacgtcctgtgccagatcggcgacgagctgttgtccaaacacgagaaggccttcagcgggatggtgcggaagt
tgaagaaggagcacagtacgatcaacggaaggtttgcggccctccggcttcgcaaggtcgcggaagagatgttctccgat
cgggaagtcaactggggtcgcatcgtcgccctcatcgtcttctgtgccgttttctcccgggacctgaacgaccaaggtcc
ggcggaggaggagatcgacctgatggtacaagaagtagccaagttcatcgtggagcacgacggctggatacgacaagagg
gtggctgggtgagtgttcatgggactgcggctcgcgtccgtgggtcctggtgttcgggtgttcttgggatgttatcaaac
ttggtttcagcaacctgtcttaaaaaatactttttatcattttgttgcactttctctttaaagttatattctggttaa
© 1998-2023Legal notice