Dataset for CDS BAX of Organism Leptobrachium leishanense

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C5PKU5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Leptobrachium leishanense GN=BAX (length=804 residues).
atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagccacggggggagagaacccggaagcggccgg
caacggaagccgaacagctgcggcaccgctggatgatgacaagatcatcaatggctatgaatgtccccgtcactcccagc
cgtggcaggtgtatttcacctataaaggtgaacgctggtgcggcgggtctctgatcaattcacaatggatcatctcagca
gcacattgttacaaatcacccaagtatttaattgctcatcttggggaacatgacaccacaaaggaagaaggaacagagca
acatattcaagtgaagaacgcatatcaatatttctactataacaacaattacatggaccacgacttcatgatggtgaaat
tagcagagccagcacagttcaaccaatacgtgcagcccatcaaagtagccagtagttgtccaactgccagtactcagtgt
ctggtgtctggatgggggaacctgctgacatctggtgtgaagtatcctgatggcctccagtgtttggagatccccgttct
ctccgaggaaagctgcaaagcgtcttattcctatcaggttacttcaaacatgttctgcgccggcttccaggatggaggga
aagactcgtgtcagggtgactctggaggaccactggcctgtaatggagagctttatggagtggtatcgtggggaaaaggc
tgcgcccagagaggttaccccggcgtatacaccaaagtgtgcaactacttagactggatcctgcatgtcattgacaatta
ttaa
>gnl|bcl2dbcds|A0A8C5PKU5_BAX-02 BCL2-associated X gene OS=[Eukaryota] Leptobrachium leishanense GN=BAX (length=747 residues).
atgataccgctctggatttggatgcttctgggggctgcagctgcggcaccgctggatgatgacaagatcatcaatggcta
tgaatgtccccgtcactcccagccgtggcaggtgtatttcacctataaaggtgaacgctggtgcggcgggtctctgatca
attcacaatggatcatctcagcagcacattgttacaaatcacccaagtatttaattgctcatcttggggaacatgacacc
acaaaggaagaaggaacagagcaacatattcaagtgaagaacgcatatcaatatttctactataacaacaattacatgga
ccacgacttcatgatggtgaaattagcagagccagcacagttcaaccaatacgtgcagcccatcaaagtagccagtagtt
gtccaactgccagtactcagtgtctggtgtctggatgggggaacctgctgacatctggtgtgaagtatcctgatggcctc
cagtgtttggagatccccgttctctccgaggaaagctgcaaagcgtcttattcctatcaggttacttcaaacatgttctg
cgccggcttccaggatggagggaaagactcgtgtcagggtgactctggaggaccactggcctgtaatggagagctttatg
gagtggtatcgtggggaaaaggctgcgcccagagaggttaccccggcgtatacaccaaagtgtgcaactacttagactgg
atcctgcatgtcattgacaattattaa
>gnl|bcl2dbcds|A0A8C5PKU5_BAX-03 BCL2-associated X gene OS=[Eukaryota] Leptobrachium leishanense GN=BAX (length=720 residues).
atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagccacggggggagagaacccggaagcggccgg
caacggaagccgaacagggacaagcacagaacagattgtggagacggggaacgtgctgctcaatgggttcattgctgacc
aagttcagaggacaccaaatagacctactgatgcattggcagagcttggggtgcagtcagctccggcggaccctcggaca
aaggaactcagtgagtgcctgcgtaaaattggagatgaactggatggaaacatggagctacagagaatgattgaacaggt
acaaagcgattctcccaaggaagtctttttcaaagtagcatccgaaatgttttctgatgggaattttaactggggccgag
tggtcgcgctcttctattttgcttcaaggcttattataaagcaccaatgtccacttgacacatttataatgagccatgct
gctactcccctcgtttgccacgccgtgggcaaggccttgttgacaaacgttccaaaaattacccgtaccatcattgattg
gacaatggaatactttcgagtcaatgttgtgcagtggattcgggatcagggaggctgggaaaatatcatttcatacgtca
gcactcctacttggcaaacagtttgtatcttcttctccggtgtattagctgccgcctttaccatctggaggatgaagtga
>gnl|bcl2dbcds|A0A8C5PKU5_BAX-04 BCL2-associated X gene OS=[Eukaryota] Leptobrachium leishanense GN=BAX (length=648 residues).
atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagccacggggggagagaacccggaagcggccgg
caacggaagccgaacagggacaagcacagaacagattgtggagacggggaacgtgctgctcaatgggttcattgctgacc
aagttcagaggacaccaaatagacctactgatgcattggcagagcttggggtgcagtcagctccggcggaccctcggaca
aaggaactcagtgagtgcctgcgtaaaattggagatgaactggatggaaacatggagctacagagaatgattgaacaggt
acaaagcgattctcccaaggaagtctttttcaaagtagcatccgaaatgttttctgatgggaattttaactggggccgag
tggtcgcgctcttctattttgcttcaaggcttattataaaggccttgttgacaaacgttccaaaaattacccgtaccatc
attgattggacaatggaatactttcgagtcaatgttgtgcagtggattcgggatcagggaggctgggaaaatatcatttc
atacgtcagcactcctacttggcaaacagtttgtatcttcttctccggtgtattagctgccgcctttaccatctggagga
tgaagtga
© 1998-2023Legal notice