Dataset for CDS MCL-1 of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1T2Q0_MCL1-02      ------atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttggggggg
G1T2Q0_MCL1-01      atggcgatgtttagcctgagaagaaacgcggtaatcggactcaacctctacttggggggg
                          ******************************************************

G1T2Q0_MCL1-02      cccgggttgggagccggtggcggcggcgtcgcccctccggcagagcggctttt-------
G1T2Q0_MCL1-01      cccgggttgggagccggtggcggcggcgtcgcccctccggcagagcggcttttggctgcg
                    *****************************************************       

G1T2Q0_MCL1-02      ------------------------------------------------------------
G1T2Q0_MCL1-01      gagaaggaggccgcggcccggctagaggtagggggaggggaggccggcgcggtgattggc
                                                                                

G1T2Q0_MCL1-02      ------------------------------------------------------------
G1T2Q0_MCL1-01      ggaagcccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcgcgcgg
                                                                                

G1T2Q0_MCL1-02      ------------------------------------------------------------
G1T2Q0_MCL1-01      ccggcgcccattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtac
                                                                                

G1T2Q0_MCL1-02      ------------------------------------------------------------
G1T2Q0_MCL1-01      ttggcgcccacccgccgcgcgtcgccgctcgaggagatggaagccccggctgcggacgcc
                                                                                

G1T2Q0_MCL1-02      ------------------------------------------------------------
G1T2Q0_MCL1-01      atcatgtcgcccgaagaggagctggacggctacgagccggagccccttgcgaagcggccg
                                                                                

G1T2Q0_MCL1-02      ------------------------------------------------------------
G1T2Q0_MCL1-01      gccgtcctgcccctgctggacttggtgggggaggccagtaaggtccctagcacggacggg
                                                                                

G1T2Q0_MCL1-02      ------------------------------------------------------------
G1T2Q0_MCL1-01      tcgctgccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcg
                                                                                

G1T2Q0_MCL1-02      --------------------------------ggcgaccggcgccaaggacgcgaagccg
G1T2Q0_MCL1-01      ctggagattatcgcccggtaccttcgggagcaggcgaccggcgccaaggacgcgaagccg
                                                    ****************************

G1T2Q0_MCL1-02      atgggccgggccggcagcgcgagccggaaggcgctcgagaccctgcggcgggtcggggac
G1T2Q0_MCL1-01      atgggccgggccggcagcgcgagccggaaggcgctcgagaccctgcggcgggtcggggac
                    ************************************************************

G1T2Q0_MCL1-02      ggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaa
G1T2Q0_MCL1-01      ggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaa
                    ************************************************************

G1T2Q0_MCL1-02      aacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgta
G1T2Q0_MCL1-01      aacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgta
                    ************************************************************

G1T2Q0_MCL1-02      acaaactggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttg
G1T2Q0_MCL1-01      acaaactggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttg
                    ************************************************************

G1T2Q0_MCL1-02      aagagcataaaccaagaaagctgcatagaacctttagcggaaagtatcacagatgttctc
G1T2Q0_MCL1-01      aagagcataaaccaagaaagctgcatagaacctttagcggaaagtatcacagatgttctc
                    ************************************************************

G1T2Q0_MCL1-02      gtcaggacgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttc
G1T2Q0_MCL1-01      gtcaggacgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttc
                    ************************************************************

G1T2Q0_MCL1-02      ttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgtt
G1T2Q0_MCL1-01      ttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgtt
                    ************************************************************

G1T2Q0_MCL1-02      gccggagtaggagcggggctggcttatctgataagatag
G1T2Q0_MCL1-01      gccggagtaggagcggggctggcttatctgataagatag
                    ***************************************

© 1998-2020Legal notice