Dataset for CDS BCL-2-like of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4C341_MCL1-01      -----------------------------------ttattttcatttgtg
A0A3B4C341_MCL1-02      atggtcaggctgttcggtgttgggttgagagtggtccactatgcaaaata
A0A3B4C341_MCL1-03      atgatgatg------------agtcccaaggagatgtattttg------a
A0A3B4DTL9_BCL2L1-      ---------------------------atg--------------------
A0A3B4CGU9_MCL1-03      ---------------------------atgga-----------gagcgc-
A0A3B4CGU9_MCL1-01      ---------------------------atggaagctcacggtggagttca
A0A3B4CGU9_MCL1-02      ---------------------------atggaagctcacggtggagttca

A0A3B4C341_MCL1-01      tgggaa---------------ttttctag-gaaatggccatggaattttc
A0A3B4C341_MCL1-02      tccaaagactgtttttccttctttgctggcgaagcgacc-----ttttac
A0A3B4C341_MCL1-03      taagaagactgtttttccttctttgctggcgaagcgacc-----ttttac
A0A3B4DTL9_BCL2L1-      ---------------tcttactacaacagagaactggttgtgtactttat
A0A3B4CGU9_MCL1-03      ---cgccat--cagcctgttctgtaacggagcggggaggatcccgttcaa
A0A3B4CGU9_MCL1-01      gatcaacatggcagctcatcctggag-gcagtatctgtgctccggttctc
A0A3B4CGU9_MCL1-02      gatcaacatggcagctcatcctggag-gcagtatctgtgctccggttctc
                                             *        *              **   

A0A3B4C341_MCL1-01      tttgggaa---------aaa------------------------------
A0A3B4C341_MCL1-02      tctgggtatatcctctcaaa------------------------------
A0A3B4C341_MCL1-03      tctgggtatatcctctcaaa------------------------------
A0A3B4DTL9_BCL2L1-      caagtacaaactctcccagaggaactatccctataaccacattgggct--
A0A3B4CGU9_MCL1-03      caagg--g------ctcggagagcc---------agctggaccg------
A0A3B4CGU9_MCL1-01      catgg--aagttcttttggaggtcc---------agtcacactgatatac
A0A3B4CGU9_MCL1-02      catgg--aagttcttttggaggtcc---------agtcacactgatatac
                           *               *                              

A0A3B4C341_MCL1-01      ------ct-------------------------------gatcgca-gct
A0A3B4C341_MCL1-02      ------cccggg--------------------cgcccaggatcgca-gct
A0A3B4C341_MCL1-03      ------cccggg--------------------cgcccaggatcgca-gct
A0A3B4DTL9_BCL2L1-      ------tatgga---------------agacacaaatcggactgaagggg
A0A3B4CGU9_MCL1-03      ------cccgga-------------ccggcccgaccgcggcctgga-ggg
A0A3B4CGU9_MCL1-01      ctcatacacggaggtcagggaggttccagttccagctcagctcagacggg
A0A3B4CGU9_MCL1-02      ctcatacacggaggtcagggaggttccagttccagctcagctcagacggg
                                                               *     * *  

A0A3B4C341_MCL1-01      gttacagacggttct-----------------------------------
A0A3B4C341_MCL1-02      gttacagacggttct-----------------------------------
A0A3B4C341_MCL1-03      gttacagacggttct-----------------------------------
A0A3B4DTL9_BCL2L1-      gt--caggcggca-------------------------------------
A0A3B4CGU9_MCL1-03      actacaggcagcgcccggacccgct-------------------------
A0A3B4CGU9_MCL1-01      ttctcctgctgctcctgaactcactcacgtccaggtcaacagcattagca
A0A3B4CGU9_MCL1-02      ttctcctgctgctcctgaactcactcacgtccaggtcaacagcattagca
                            *   * *                                       

A0A3B4C341_MCL1-01      ---------------------ctaccaacgtcccccgcgtcggattgtga
A0A3B4C341_MCL1-02      ---------------------ctaccaacgtcccccgcgtcggattgtga
A0A3B4C341_MCL1-03      ---------------------ctaccaacgtcccccgcgtcggattgtga
A0A3B4DTL9_BCL2L1-      -----------gaggag---------------------aacgcagagggg
A0A3B4CGU9_MCL1-03      --------agcaagg------ccgcca----------tggccggagggtc
A0A3B4CGU9_MCL1-01      ttagcagcaccaaggagcaaaccaccatcagcctgtgtgacggagaggtg
A0A3B4CGU9_MCL1-02      ttagcagcaccaaggagcaaaccaccatcagcctgtgtgacggagaggtg
                                                                *     *   

A0A3B4C341_MCL1-01      ggagt-tggactca--------------------gaccaattcaaggaat
A0A3B4C341_MCL1-02      ggagt-tggactca--------------------gaccaattcaaggaat
A0A3B4C341_MCL1-03      ggagt-tggactca--------------------gaccaattcaaggaat
A0A3B4DTL9_BCL2L1-      gcggcggtgac-----------------------gcccacggcagttgtc
A0A3B4CGU9_MCL1-03      gctgc-ccgagtccccggagtccgacgacttcgtgcccgacttcggcggc
A0A3B4CGU9_MCL1-01      accgtgctgattaaaccgaaaccaaag-------ggccgagtcagg----
A0A3B4CGU9_MCL1-02      accgtgctgattaaaccgaaaccaaag-------ggccgagtcagg----
                           *    **                        * **            

A0A3B4C341_MCL1-01      ctgaaactttggacagagacacttcagaaatagtcattgactttttgcaa
A0A3B4C341_MCL1-02      ctgaaactttggacagagacacttcagaaatagtcattgactttttgcaa
A0A3B4C341_MCL1-03      ctgaaactttggacagagacacttcagaaatagtcattgactttttgcaa
A0A3B4DTL9_BCL2L1-      aacggatccgtaaatgggacaagtcacggtccagcggggtcgcccacc--
A0A3B4CGU9_MCL1-03      agcgccctggtggaggagacc--cggcggctcatcgggggcttttaccgc
A0A3B4CGU9_MCL1-01      ------ctggaggaggagacc--ctctgcatcatcggggatttttaccag
A0A3B4CGU9_MCL1-02      ------ctggaggaggagacc--ctctgcatcatcggggatttttaccag
                                       * ***              *   *        *  

A0A3B4C341_MCL1-01      aacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtaca
A0A3B4C341_MCL1-02      aacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtaca
A0A3B4C341_MCL1-03      aacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtaca
A0A3B4DTL9_BCL2L1-      ---tcttccccccaa---agaa----ggtccaac----------gg---g
A0A3B4CGU9_MCL1-03      ggatatatcggccag---aagacccgggaccagcaccccgcccacg---g
A0A3B4CGU9_MCL1-01      ggatac------------aggagccgaaaccagcacccagcctcgg---a
A0A3B4CGU9_MCL1-02      ggatac------------aggagccgaaaccagcacccagcctcgg---a
                           *                          *  *           *    

A0A3B4C341_MCL1-01      gacaataaggagggtg--gtggacggcctggtggtgaagcatgagctcgt
A0A3B4C341_MCL1-02      gacaataaggagggtg--gtggacggcctggtggtgaagcatgagctcgt
A0A3B4C341_MCL1-03      gacaataaggagggtg--gtggacggcctggtggtgaagcatgagctcgt
A0A3B4DTL9_BCL2L1-      gccggagggctggacgccgtgaagg-----------aagcactgcgggac
A0A3B4CGU9_MCL1-03      cacgatgagcagggtg--gtggagggggtgatcctcaagcacagcatcgc
A0A3B4CGU9_MCL1-01      cacgctgagcagagtg--gtggaggggatgctccacaaacacagtgttgc
A0A3B4CGU9_MCL1-02      cacgctgagcagagtg--gtggaggggatgctccacaaacacagtgttgc
                          *     *  *   *  *** * *           ** **         

A0A3B4C341_MCL1-01      cta--caaaggtatgtttactaggc-----tgggtatggaagaca-----
A0A3B4C341_MCL1-02      cta--caaaggtatgtttactaggc-----tgggtatggaagaca-----
A0A3B4C341_MCL1-03      cta--caaaggtatgtttactaggc-----tgggtatggaagaca-----
A0A3B4DTL9_BCL2L1-      tcagccaacgagtttgagctgcgatattcacgcgcctttagcgacctctc
A0A3B4CGU9_MCL1-03      gta--caacggtatggtccagcgat-----tgtgtttggagcagc-----
A0A3B4CGU9_MCL1-01      cta--cagcggtatggtccagcgat-----tgtgtttggagcagc-----
A0A3B4CGU9_MCL1-02      cta--cagcggtatggtccagcgat-----tgtgtttggagcagc-----
                          *  **  *   *        *        * *  *  *          

A0A3B4C341_MCL1-01      -------------gaggagatga-catgcatataattagg------acag
A0A3B4C341_MCL1-02      -------------gaggagatga-catgcatataattagg------acag
A0A3B4C341_MCL1-03      -------------gaggagatga-catgcatataattagg------acag
A0A3B4DTL9_BCL2L1-      ctcccagctccatatcacgccagccacggcgtatcagagcttcgaaagcg
A0A3B4CGU9_MCL1-03      -------------aagacgatag-catggagtttattagc------agtg
A0A3B4CGU9_MCL1-01      -------------aagacgatag-catggagtttattagc------agtg
A0A3B4CGU9_MCL1-02      -------------aagacgatag-catggaatttattagc------agcg
                                          *     ** *         **       *  *

A0A3B4C341_MCL1-01      tggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgcc
A0A3B4C341_MCL1-02      tggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgcc
A0A3B4C341_MCL1-03      tggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgcc
A0A3B4DTL9_BCL2L1-      tgatggacgaggtgttccgagacgg---cgtcaactggggccgtgttgtg
A0A3B4CGU9_MCL1-03      tggcgaagaccctgttcaatgatgggaccaccaactgggggcggattgcc
A0A3B4CGU9_MCL1-01      tggcgaagaccctgttcaatgatgggaccaccaactgggggcggattgcc
A0A3B4CGU9_MCL1-02      tggcgaagaccctgtttgatgatgggatcaccaactgggggcggattgcc
                        **    *     * **    ** **   *  ********* **  * *  

A0A3B4C341_MCL1-01      agcctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatggg
A0A3B4C341_MCL1-02      agcctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatggg
A0A3B4C341_MCL1-03      agcctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatggg
A0A3B4DTL9_BCL2L1-      ggcctgttcgcgttcggtggggc--cctgtgcgtgg--------------
A0A3B4CGU9_MCL1-03      agtctggtggcgtttggtgcggtggtctgtgagcagatgaaggaagcagg
A0A3B4CGU9_MCL1-01      agtctggtggcgtttggtgcggtggtctgtgagcagatgaaggaagcagg
A0A3B4CGU9_MCL1-02      agtctggtggcgttgggtgcggtggtctgtgagtggctgaaggaggtggg
                         * *** * ** ** ****  *     **   *                 

A0A3B4C341_MCL1-01      ccgaggtcactgcgtgagtcttg------------tgggccaagagattt
A0A3B4C341_MCL1-02      ccgaggtcactgcgtgagtcttg------------tgggccaagagattt
A0A3B4C341_MCL1-03      ccgaggtcactgcgtgagtcttg------------tgggccaagagattt
A0A3B4DTL9_BCL2L1-      --------agtgtgtggaaaaggagatgagcccactcgtgggacgcatcg
A0A3B4CGU9_MCL1-03      cagagagcagtgtgtggagaacg------------tcatacaacacatct
A0A3B4CGU9_MCL1-01      cagagagcagtgtgtggagaacg------------tcatacaacacatct
A0A3B4CGU9_MCL1-02      cagagagcagtgtgtggagaacg------------tcatacaacacatct
                                * ** ***      *            *      *   **  

A0A3B4C341_MCL1-01      cctcatatcttctttcagaccaa------------aaagactggctactg
A0A3B4C341_MCL1-02      cctcatatcttctttcagaccaa------------aaagactggctactg
A0A3B4C341_MCL1-03      cctcatatcttctttcagaccaa------------aaagactggctactg
A0A3B4DTL9_BCL2L1-      cagagtggatgactgtctacttggacaaccatatccagccctggatc--c
A0A3B4CGU9_MCL1-03      caacgtacctcagtacagaccag------------cgacagtggctcatc
A0A3B4CGU9_MCL1-01      caacgtacctcagtacagaccag------------cgacagtggctcatc
A0A3B4CGU9_MCL1-02      caatgtacctcagtacagaccag------------cgacagtggctcatc
                        *    *   *   *    **                     *** *    

A0A3B4C341_MCL1-01      aaaaataa--agcatgggatggctttgtggagttttttcatgtcccggat
A0A3B4C341_MCL1-02      aaaaataa--agcatgggatggctttgtggagttttttcatgtcccggat
A0A3B4C341_MCL1-03      aaaaataa--agcatgggatggctttgtggagttttttcatgtcccggat
A0A3B4DTL9_BCL2L1-      aggaacaaggaggatgggagcgctttgcagagatctttgggaaggatgcc
A0A3B4CGU9_MCL1-03      aacaacaa--agcctggggaggttttgtggagttcttccgtgaagacgac
A0A3B4CGU9_MCL1-01      aacaacaa--agcctggggaggttttgtggagttcttccgtgaagacgac
A0A3B4CGU9_MCL1-02      aacaacaa--agcctggggaggttttgtggagttcttccgtgaagacgac
                        *  ** **  **  ****   * ****  *** * **          *  

A0A3B4C341_MCL1-01      cccg------------agtcaaaaatgaggaatgcattaa----tggcc-
A0A3B4C341_MCL1-02      cccg------------agtcaaaaatgaggaatgcattaa----tggcc-
A0A3B4C341_MCL1-03      cccg------------agtcaaaaatgaggaatgcattaa----tggcc-
A0A3B4DTL9_BCL2L1-      gcagcagagagcagaaggtcaca-----ggagaactttaagaagtggctg
A0A3B4CGU9_MCL1-03      tccg------------agtcacgcgtacggaacgctctta----tggcc-
A0A3B4CGU9_MCL1-01      tccg------------agtcacgcgtacggaacgctctta----tggcc-
A0A3B4CGU9_MCL1-02      tccg------------agtcacgcgtacggaacgctctta----tggcc-
                         * *             ****       ***   *  * *    ****  

A0A3B4C341_MCL1-01      ttggt--tactgcagcaggt--gttggagcaggacttgttttattgtcaa
A0A3B4C341_MCL1-02      ttggt--tactgcagcaggt--gttggagcaggacttgttttattgtcaa
A0A3B4C341_MCL1-03      ttggt--tactgcagcaggt--gttggagcaggacttgttttattgtcaa
A0A3B4DTL9_BCL2L1-      ctggcagggatgaccctggtcacaggggttgtggtgggctccctcatcgc
A0A3B4CGU9_MCL1-03      ttcgcgggatt--cgctggc--ctgggggcggggctagcactactgatgc
A0A3B4CGU9_MCL1-01      ttcgcgggatt--cgctggc--ctgggggcggggctagcactactgatgc
A0A3B4CGU9_MCL1-02      ttcgcgggatt--cgctggc--ctgggggcggggctagcactactgatgc
                         * *      *    * **      **     *    *            

A0A3B4C341_MCL1-01      gataa-----------
A0A3B4C341_MCL1-02      gataa-----------
A0A3B4C341_MCL1-03      gataa-----------
A0A3B4DTL9_BCL2L1-      tcagaagcgtctgtaa
A0A3B4CGU9_MCL1-03      gctga-----------
A0A3B4CGU9_MCL1-01      gctga-----------
A0A3B4CGU9_MCL1-02      gctga-----------

© 1998-2022Legal notice