Dataset for CDS BCL-2-like of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4C6H5_MCL1-01      ----------------------ttattttc----------atttgtgtgg
A0A3B4C6H5_MCL1-03      atg---------------atgatgagtcccaaggagatgtattttgataa
A0A3B4DTL9_BCL2L1-      atg-----------------------------------tcttactacaac
A0A3B4CGU9_MCL1-03      atgga-----------gagcgc----cgccat--cagcctgttctgtaac
A0A3B4CGU9_MCL1-02      atggaagctcacggtggagttcagatcaacatggcagctcatcctggag-
                                                                 *        

A0A3B4C6H5_MCL1-01      gaa---------------ttttctag-gaaatggccatggaattttcttt
A0A3B4C6H5_MCL1-03      gaagactgtttttccttctttgctggcgaagcgacc-----ttttactct
A0A3B4DTL9_BCL2L1-      agagaactggttgtgtactttatcaagtac-----------aaactctcc
A0A3B4CGU9_MCL1-03      ggagcggggaggatcccgttcaacaaggg-----------------ctc-
A0A3B4CGU9_MCL1-02      gcagtatctgtgctccggttctccatggaa-----------gttctttt-
                          *               **                           *  

A0A3B4C6H5_MCL1-01      gggaa---------aaac-------t-----------g------------
A0A3B4C6H5_MCL1-03      gggtatatcctctcaaac-------ccgggcgcccagg------------
A0A3B4DTL9_BCL2L1-      cagaggaactatccctataaccacattgggcttatgga------------
A0A3B4CGU9_MCL1-03      --ggagagccagctggaccg------------cccgga------------
A0A3B4CGU9_MCL1-02      --ggaggtccagtcacactgatatacctcatacacggaggtcagggaggt
                          *             *                                 

A0A3B4C6H5_MCL1-01      ---------atcgcagct--------gttacagacggttct---------
A0A3B4C6H5_MCL1-03      ---------atcgcagct--------gttacagacggttct---------
A0A3B4DTL9_BCL2L1-      ---agacacaaatcggactgaagggggt--caggcggca-----------
A0A3B4CGU9_MCL1-03      -ccggcccgaccgcggcctgga-gggactacaggcagcgcccggacccgc
A0A3B4CGU9_MCL1-02      tccagttccagctcagctcagacgggttctcctgctgctcctgaactcac
                                 *   * *              *   * *             

A0A3B4C6H5_MCL1-01      -----------------------------------------------cta
A0A3B4C6H5_MCL1-03      -----------------------------------------------cta
A0A3B4DTL9_BCL2L1-      -------------------------------------gaggag-------
A0A3B4CGU9_MCL1-03      t---------------------------------agcaagg------ccg
A0A3B4CGU9_MCL1-02      tcacgtccaggtcaacagcattagcattagcagcaccaaggagcaaacca
                                                                          

A0A3B4C6H5_MCL1-01      ccaacgtcccccgcgtcggattgtgaggagt-tggactca----------
A0A3B4C6H5_MCL1-03      ccaacgtcccccgcgtcggattgtgaggagt-tggactca----------
A0A3B4DTL9_BCL2L1-      --------------aacgcagagggggcggcggtgac-------------
A0A3B4CGU9_MCL1-03      cca----------tggccggagggtcgctgc-ccgagtccccggagtccg
A0A3B4CGU9_MCL1-02      ccatcagcctgtgtgacggagaggtgaccgtgctgattaaaccgaaacca
                                        *     *      *    **              

A0A3B4C6H5_MCL1-01      ----------gaccaattcaaggaatctgaaactttggacagagacactt
A0A3B4C6H5_MCL1-03      ----------gaccaattcaaggaatctgaaactttggacagagacactt
A0A3B4DTL9_BCL2L1-      ----------gcccacggcagttgtcaacggatccgtaaatgggacaagt
A0A3B4CGU9_MCL1-03      acgacttcgtgcccgacttcggcggcagcgccctggtggaggagacc--c
A0A3B4CGU9_MCL1-02      aag-------ggccgagtcagg----------ctggaggaggagacc--c
                                  * **                           * ***    

A0A3B4C6H5_MCL1-01      cagaaatagtcattgactttttgcaaaacttcaccgggctgtctcggtcc
A0A3B4C6H5_MCL1-03      cagaaatagtcattgactttttgcaaaacttcaccgggctgtctcggtcc
A0A3B4DTL9_BCL2L1-      cacggtccagcggggtcgcccacc-----tcttccccccaa---agaa--
A0A3B4CGU9_MCL1-03      ggcggctcatcgggggcttttaccgcggatatatcggccag---aagacc
A0A3B4CGU9_MCL1-02      tctgcatcatcggggatttttaccagggatac------------aggagc
                                  *   *        *     *                    

A0A3B4C6H5_MCL1-01      tgtggtcggcaccgtggggttgtacagacaataaggagggtg--gtggac
A0A3B4C6H5_MCL1-03      tgtggtcggcaccgtggggttgtacagacaataaggagggtg--gtggac
A0A3B4DTL9_BCL2L1-      --ggtccaac----------gg---ggccggagggctggacgccgtgaag
A0A3B4CGU9_MCL1-03      cgggaccagcaccccgcccacg---gcacgatgagcagggtg--gtggag
A0A3B4CGU9_MCL1-02      cgaaaccagcacccagcctcgg---acacgctgagcagagtg--gtggag
                              *  *           *      *     *  *   *  *** * 

A0A3B4C6H5_MCL1-01      ggcctggtggtgaagcatgagctcgtcta--caaaggtatgtttactagg
A0A3B4C6H5_MCL1-03      ggcctggtggtgaagcatgagctcgtcta--caaaggtatgtttactagg
A0A3B4DTL9_BCL2L1-      g-----------aagcactgcgggactcagccaacgagtttgagctgcga
A0A3B4CGU9_MCL1-03      ggggtgatcctcaagcacagcatcgcgta--caacggtatggtccagcga
A0A3B4CGU9_MCL1-02      gggatgctccacaaacacagtgttgccta--cagcggtatggtccagcga
                        *           ** **           *  **  *   *        * 

A0A3B4C6H5_MCL1-01      c-----tgggtatggaagaca------------------gaggagatga-
A0A3B4C6H5_MCL1-03      c-----tgggtatggaagaca------------------gaggagatga-
A0A3B4DTL9_BCL2L1-      tattcacgcgcctttagcgacctctcctcccagctccatatcacgccagc
A0A3B4CGU9_MCL1-03      t-----tgtgtttggagcagc------------------aagacgatag-
A0A3B4CGU9_MCL1-02      t-----tgtgtttggagcagc------------------aagacgatag-
                               * *  *  *                            *     

A0A3B4C6H5_MCL1-01      catgcatataattagg------acagtggctaaggagctcttcagcgatg
A0A3B4C6H5_MCL1-03      catgcatataattagg------acagtggctaaggagctcttcagcgatg
A0A3B4DTL9_BCL2L1-      cacggcgtatcagagcttcgaaagcgtgatggacgaggtgttccgagacg
A0A3B4CGU9_MCL1-03      catggagtttattagc------agtgtggcgaagaccctgttcaatgatg
A0A3B4CGU9_MCL1-02      catggaatttattagc------agcgtggcgaagaccctgtttgatgatg
                        ** *         **       *  ***    *     * **    ** *

A0A3B4C6H5_MCL1-01      gcatcaccaactggggtcgaatcgccagcctgctggcctttggtgcagtg
A0A3B4C6H5_MCL1-03      gcatcaccaactggggtcgaatcgccagcctgctggcctttggtgcagtg
A0A3B4DTL9_BCL2L1-      g---cgtcaactggggccgtgttgtgggcctgttcgcgttcggtggggc-
A0A3B4CGU9_MCL1-03      ggaccaccaactgggggcggattgccagtctggtggcgtttggtgcggtg
A0A3B4CGU9_MCL1-02      ggatcaccaactgggggcggattgccagtctggtggcgttgggtgcggtg
                        *   *  ********* **  * *   * *** * ** ** ****  *  

A0A3B4C6H5_MCL1-01      gtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttg-
A0A3B4C6H5_MCL1-03      gtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttg-
A0A3B4DTL9_BCL2L1-      -cctgtgcgtgg----------------------agtgtgtggaaaagga
A0A3B4CGU9_MCL1-03      gtctgtgagcagatgaaggaagcaggcagagagcagtgtgtggagaacg-
A0A3B4CGU9_MCL1-02      gtctgtgagtggctgaaggaggtgggcagagagcagtgtgtggagaacg-
                           **   *                         * ** ***      * 

A0A3B4C6H5_MCL1-01      -----------tgggccaagagatttcctcatatcttctttcagaccaa-
A0A3B4C6H5_MCL1-03      -----------tgggccaagagatttcctcatatcttctttcagaccaa-
A0A3B4DTL9_BCL2L1-      gatgagcccactcgtgggacgcatcgcagagtggatgactgtctacttgg
A0A3B4CGU9_MCL1-03      -----------tcatacaacacatctcaacgtacctcagtacagaccag-
A0A3B4CGU9_MCL1-02      -----------tcatacaacacatctcaatgtacctcagtacagaccag-
                                   *      *   **  *    *   *   *    **    

A0A3B4C6H5_MCL1-01      -----------aaagactggctactgaaaaataa--agcatgggatggct
A0A3B4C6H5_MCL1-03      -----------aaagactggctactgaaaaataa--agcatgggatggct
A0A3B4DTL9_BCL2L1-      acaaccatatccagccctggatc--caggaacaaggaggatgggagcgct
A0A3B4CGU9_MCL1-03      -----------cgacagtggctcatcaacaacaa--agcctggggaggtt
A0A3B4CGU9_MCL1-02      -----------cgacagtggctcatcaacaacaa--agcctggggaggtt
                                         *** *    *  ** **  **  ****   * *

A0A3B4C6H5_MCL1-01      ttgtggagttttttcatgtcccggatcccg------------agtcaaaa
A0A3B4C6H5_MCL1-03      ttgtggagttttttcatgtcccggatcccg------------agtcaaaa
A0A3B4DTL9_BCL2L1-      ttgcagagatctttgggaaggatgccgcagcagagagcagaaggtcaca-
A0A3B4CGU9_MCL1-03      ttgtggagttcttccgtgaagacgactccg------------agtcacgc
A0A3B4CGU9_MCL1-02      ttgtggagttcttccgtgaagacgactccg------------agtcacgc
                        ***  *** * **          *   * *             ****   

A0A3B4C6H5_MCL1-01      atgaggaatgcattaa----tggcc-ttggt--tactgcagcaggt--gt
A0A3B4C6H5_MCL1-03      atgaggaatgcattaa----tggcc-ttggt--tactgcagcaggt--gt
A0A3B4DTL9_BCL2L1-      ----ggagaactttaagaagtggctgctggcagggatgaccctggtcaca
A0A3B4CGU9_MCL1-03      gtacggaacgctctta----tggcc-ttcgcgggatt--cgctggc--ct
A0A3B4CGU9_MCL1-02      gtacggaacgctctta----tggcc-ttcgcgggatt--cgctggc--ct
                            ***   *  * *    ****   * *      *    * **     

A0A3B4C6H5_MCL1-01      tggagcaggacttgttttattgtcaagataa-----------
A0A3B4C6H5_MCL1-03      tggagcaggacttgttttattgtcaagataa-----------
A0A3B4DTL9_BCL2L1-      ggggttgtggtgggctccctcatcgctcagaagcgtctgtaa
A0A3B4CGU9_MCL1-03      gggggcggggctagcactactgatgcgctga-----------
A0A3B4CGU9_MCL1-02      gggggcggggctagcactactgatgcgctga-----------
                         **     *    *                *           

© 1998-2020Legal notice