Dataset for CDS MCL-1 of organism Panthera tigris altaica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9K7H4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Panthera tigris altaica GN=MCL-1 (length=573 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggctggcggccgggagcggcgg
cgcctccgcgactggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccac
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
© 1998-2022Legal notice