Dataset for CDS BAX of Organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A4W5KF37_BAX-01 BCL2-associated X gene OS=[Eukaryota] Hucho hucho GN=BAX (length=630 residues).
atgtcacatgactgcaggcggaagcagactcaaagtactcttaaaatggcagcgccgtctggaggaggcgattcaggtaa
tggaactgatcaggtactagaactgggggaaaaattactgacagatttcatctacgagcgggttcttcgccatgctgaca
gcagtactcagttgtcagtgtcacggacccagttgggcgggagtgagctgtgtgaccccaaccacaagaaactggcccta
tgcctgcagcagattggagatgagctggatggcaatacgcagctccaaagtatgttaaatgatactgcactccagcccag
ccaggaggtttttatgagagtggcctgtgagatcttctctgatgggaagttcaactggggcagggtggtggcactcttct
actttgcctgtcggctggtcatcaaggctctgttgaccaaggtccccgacatcatcagaaccattatcagctgggccaca
gactacctgcgagatcatgtgatcaactggattagggagcagggtggctgggagggaatccgttcctactttggcactcc
cacctggcagaccgtgggggtgttcctcgctggagttcttaccactgtgctggtcatccgcaagatgtga
>gnl|bcl2dbcds|A0A4W5KP29_BAX-01 BCL2-associated X gene OS=[Eukaryota] Hucho hucho GN=BAX (length=525 residues).
atggatcaagcagctgtaactctgagaggctacgttatagagagattcagagcagaagggatacagctgtctcctgaaga
gctgggtggaacacctaatgaactccagggccatgagttgaaagagatagtggacgggctactggagactactgaggaac
tgaacacaaatactgagcttcaaggcttaataagtgaagtctcggtctattgtatccaggatgttttctttgcaacaacc
aaggagattttcacagatggaattaacttgggcaaagtggcagcccttcatcacctggcctacaagcttattcacagagc
acatacacagaaccaaccccaagtcatggttaacataatcaactggactctacagttaatgagggaaaacctttactctt
ggatcagtcgggaagtatggaaagcgtcccaaaaggtgtcatggtggtgcagcaagtgctgcggccatagcatactggag
gaaacatcgctgagctcttcacagggagaagtgctgcggccatag
>gnl|bcl2dbcds|A0A4W5MLR0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Hucho hucho GN=BAX (length=615 residues).
atggcagactcccgagaaagaaggaaaaccggcgaagatgagcctcagggtgcagtcgggggtgaagatgtcatcgatga
cagaattatggagcaaggagctgttgttttaagagggtatgtcatagagaggatcagtgcagaaaactcagagaggcgtt
tggctccagaggaccttggtggcagacccaacgaactagaggaccgccaagtcaaagacgtggtacaccagctgctgctg
atcgctgatgacctgaacagaaatgctgagctacaacacctaataagcacagtccaggtaaactgtgcccaggatgtgtt
cttctcagtggccagggaaatttttgcagatggtatcaactggggcagagtggtctccctgtttcacctggcctacaagc
ttatttacaaggcactgacacagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
aatgtctccgcttggatccggcagcaaggaggatgggaggcggttgttagcaccgtgtcacattggcgtactctgtcgct
tgtggctgcagtggctttcgtgacggccatggtttactggaggaaatcacgctga
>gnl|bcl2dbcds|A0A4W5NT98_BAX-01 BCL2-associated X gene OS=[Eukaryota] Hucho hucho GN=BAX (length=879 residues).
atgctgcaagaaaaacgcagcgttccattcaaaattaatttacttctggtgtatcaaaacggaaaggcacagtcggtgtg
tccgaagcgtaagaagaggcacagtttagacacacaagcagcccagggcacttgcacaacccactgtgtatttccgtgtt
acttccttgttctgtcttgtctttggtttgtggttactgattgggacagacccgccgaggagatcaggagctgtaggact
tcttcgccccagtacttcctgtcgatggcagactccagagaaagaaggaaacccggcgaagatgagcctcagggtgcagt
cgggggtgaagatgtcatcgacgacagaattatggaacaaggagctattgttttaagagggtatgtcatagagaggatca
gtgccgaaaacccagagaggcatttggctccagaggaccttggtggcagacccaacgaacaagaggaccaccaagtcaaa
gacgtggtacaccagctgctgctgattgctgatgacctgaacagaaatgctgagctacaacacctaataagcacagtcca
ggtaaactgtgcccgggatgtgttcttctcagtggccagggaaatctttgcagatggtatcaactggggcagagtggtct
ccctgtttcacttggcctacaagcttatttacaaggcactgacacagaaccacttagaaatcatcaagaaggttattagc
tgggtattacagttcatcagggaaaatgtctcctcttggatccgacagcaaggaggatgggaggcggttgttagcactgt
gtcacattggcgtacggtgtcgcttgtggctgcagtggctttcgtgacggtcatggtttactggaggaaaacacgctga
>gnl|bcl2dbcds|A0A4W5RVD3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Hucho hucho GN=BAX (length=585 residues).
atggcagcgccgtcgggaggaggcgattcaggtaatggaactgatcaggtactagaactgggaagaagattactgacaga
tttcatctacgagcgggttcgtcgccatgctgacagcagtactcagttgtcagtgttacagacccagttgggcgggagtg
agctgtgtgaccccaaccacaagaaactggcccagtgcctgcagcagattggagatgagctggatggcaatacacaactc
caaagtatgataaatgatactgcactccagcccagccaggaggtttttatgagagtggcctgtgagatcttctctgatgg
gaagttcaactggggcagggtggtggcactcttctactttgcctgtcgcctagtcatcaaggctctgttgaccaagatcc
ccgacatcatcagaaccattatcagctgggccacagactacctgcgagatcatgtgatcaactggattagggagcagggt
ggctgggagggaatccgttcctactttggcactcccacctggcagaccgtgggggtgttcctcgctggagttcttaccac
tgtgctggtcatccgcaagatgtga
© 1998-2023Legal notice