Dataset for CDS BAX of Organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      atgctgcaagaaaaacgcagcgttccattcaaaattaatttacttctggt
                                                                         

A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      gtatcaaaacggaaaggcacagtcggtgtgtccgaagcgtaagaagaggc
                                                                         

A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      acagtttagacacacaagcagcccagggcacttgcacaacccactgtgta
                                                                         

A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      tttccgtgttacttccttgttctgtcttgtctttggtttgtggttactga
                                                                         

A0A4W5KF37_BAX-01      -------------------atgtcacatgactgcaggcggaagcagactc
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      ttgggacagacccgccgaggagatcaggagctgtaggacttcttcgcccc
                                                                         

A0A4W5KF37_BAX-01      aaagtactcttaaaatggcagcgccgtctggaggaggcgattcaggtaat
A0A4W5RVD3_BAX-01      --------------atggcagcgccgtcgggaggaggcgattcaggtaat
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------atggcagactcccgagaaagaaggaaaaccggcgaa
A0A4W5NT98_BAX-01      agtacttcctgtcgatggcagactccagagaaagaaggaaacccggcgaa
                                                                         

A0A4W5KF37_BAX-01      ggaactgatcagg------------------------------------t
A0A4W5RVD3_BAX-01      ggaactgatcagg------------------------------------t
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      gatgagcctcagggtgcagtcgggggtgaagatgtcatcgatgacagaat
A0A4W5NT98_BAX-01      gatgagcctcagggtgcagtcgggggtgaagatgtcatcgacgacagaat
                                                                         

A0A4W5KF37_BAX-01      actagaactgggggaaaaattactgacagatttcatctacgagcgggttc
A0A4W5RVD3_BAX-01      actagaactgggaagaagattactgacagatttcatctacgagcgggttc
A0A4W5KP29_BAX-01      -atggatcaagcagctgtaactctgagaggctacgttatagagagatt--
A0A4W5MLR0_BAX-01      tatggagcaaggagctgttgttttaagagggtatgtcatagagaggat--
A0A4W5NT98_BAX-01      tatggaacaaggagctattgttttaagagggtatgtcatagagaggat--
                         * ** *  *            * * **  *   *    *** *  *  

A0A4W5KF37_BAX-01      ttcgccatgctgacagc---agtactcagttgtcagtgtcacggacccag
A0A4W5RVD3_BAX-01      gtcgccatgctgacagc---agtactcagttgtcagtgttacagacccag
A0A4W5KP29_BAX-01      ----cagagcaga------agggatacagctgtc--tcctgaagagctgg
A0A4W5MLR0_BAX-01      ----cagtgcagaaaactcagagaggcgtttggc--tccagaggaccttg
A0A4W5NT98_BAX-01      ----cagtgccgaaaacccagagaggcatttggc--tccagaggaccttg
                           *   ** **          *  *   ** *  *      ** *  *

A0A4W5KF37_BAX-01      ttgggcgg--gagtgagctgtgtgaccccaaccacaagaaactggcccta
A0A4W5RVD3_BAX-01      ttgggcgg--gagtgagctgtgtgaccccaaccacaagaaactggcccag
A0A4W5KP29_BAX-01      gtggaacacctaatgaactccagggccatgagttgaaagagatagtggac
A0A4W5MLR0_BAX-01      gtggcagacccaacgaactagaggaccgccaagtcaaagacgtggtacac
A0A4W5NT98_BAX-01      gtggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacac
                        ***       *  ** *     * **   *    **  *  * *     

A0A4W5KF37_BAX-01      tgcctgcagcagattggagatgagctggatggcaatacgcagctccaaag
A0A4W5RVD3_BAX-01      tgcctgcagcagattggagatgagctggatggcaatacacaactccaaag
A0A4W5KP29_BAX-01      gggctactggagactactgaggaactgaacacaaatactgagcttcaagg
A0A4W5MLR0_BAX-01      cagctgctgctgatcgctgatgacctgaacagaaatgctgagctacaaca
A0A4W5NT98_BAX-01      cagctgctgctgattgctgatgacctgaacagaaatgctgagctacaaca
                          ** * *  **     ** ** *** *    *** *  * ** ***  

A0A4W5KF37_BAX-01      tatgttaaatgatactgcactccagcccagccaggaggtttttatgagag
A0A4W5RVD3_BAX-01      tatgataaatgatactgcactccagcccagccaggaggtttttatgagag
A0A4W5KP29_BAX-01      cttaataagtgaagtctcggtctattgtatccaggatgttttctttgcaa
A0A4W5MLR0_BAX-01      cctaataagcacagtccaggtaaactgtgcccaggatgtgttcttctcag
A0A4W5NT98_BAX-01      cctaataagcacagtccaggtaaactgtgcccgggatgtgttcttctcag
                         *  ***            *  *      ** *** ** **  *   * 

A0A4W5KF37_BAX-01      tggcctgtgagatcttctctgatgggaagttcaactggggcagggtggtg
A0A4W5RVD3_BAX-01      tggcctgtgagatcttctctgatgggaagttcaactggggcagggtggtg
A0A4W5KP29_BAX-01      caaccaaggagattttcacagatggaa---ttaacttgggcaaagtggca
A0A4W5MLR0_BAX-01      tggccagggaaatttttgcagatggta---tcaactggggcagagtggtc
A0A4W5NT98_BAX-01      tggccagggaaatctttgcagatggta---tcaactggggcagagtggtc
                          **   ** ** **  * ***** *   * **** *****  ****  

A0A4W5KF37_BAX-01      gcactcttctactttgcctgtcggctggtcatcaaggctctgttgaccaa
A0A4W5RVD3_BAX-01      gcactcttctactttgcctgtcgcctagtcatcaaggctctgttgaccaa
A0A4W5KP29_BAX-01      gcccttcatcacctggcctacaagcttattcacagagcacatacacagaa
A0A4W5MLR0_BAX-01      tccctgtttcacctggcctacaagcttatttacaaggcactgacacagaa
A0A4W5NT98_BAX-01      tccctgtttcacttggcctacaagcttatttacaaggcactgacacagaa
                        * **     ** * ****     **  *   **  ** *        **

A0A4W5KF37_BAX-01      ggtccccgacatcatcagaaccattatcagctgggccacagactacctgc
A0A4W5RVD3_BAX-01      gatccccgacatcatcagaaccattatcagctgggccacagactacctgc
A0A4W5KP29_BAX-01      ccaaccccaagtcatggttaacataatcaactggactctacagttaatga
A0A4W5MLR0_BAX-01      ccacttagaaatcatcaagaaggttattagctgggtattacagttcatca
A0A4W5NT98_BAX-01      ccacttagaaatcatcaagaaggttattagctgggtattacagttcatca
                               *  ****    *   * ** * ****     * * *   *  

A0A4W5KF37_BAX-01      gagatcatgtgatcaactggattagggagcagggtggctgggagggaatc
A0A4W5RVD3_BAX-01      gagatcatgtgatcaactggattagggagcagggtggctgggagggaatc
A0A4W5KP29_BAX-01      gggaaaacctttactcttggatcagtcgg---gaagtatggaaagcg---
A0A4W5MLR0_BAX-01      gggaaaatgtctccgcttggatccggcagcaaggaggatgggaggcggt-
A0A4W5NT98_BAX-01      gggaaaatgtctcctcttggatccgacagcaaggaggatgggaggcggt-
                       * **  *  *   *   *****  *   *   *  *  *** * *     

A0A4W5KF37_BAX-01      cgttcctactttggcactcccacctggcagaccgtgggggtgttcctcgc
A0A4W5RVD3_BAX-01      cgttcctactttggcactcccacctggcagaccgtgggggtgttcctcgc
A0A4W5KP29_BAX-01      -tcccaaaaggtgtcat-----ggtggtgca-----------------gc
A0A4W5MLR0_BAX-01      tgttagcaccgtgtcac-----attggcgtactctgtcgcttgtggctgc
A0A4W5NT98_BAX-01      tgttagcactgtgtcac-----attggcgtacggtgtcgcttgtggctgc
                              *   ** **        ***   *                 **

A0A4W5KF37_BAX-01      tggagttcttaccactgtgctggtcatccgcaagatg------tga----
A0A4W5RVD3_BAX-01      tggagttcttaccactgtgctggtcatccgcaagatg------tga----
A0A4W5KP29_BAX-01      aagtgct------gcggccatagcatactggaggaaacatcgctgagctc
A0A4W5MLR0_BAX-01      agtggctttcgtgacggccatggtttactggaggaaatcacgctga----
A0A4W5NT98_BAX-01      agtggctttcgtgacggtcatggtttactggaggaaaacacgctga----
                           * *       * *   * *    * * * **        ***    

A0A4W5KF37_BAX-01      ----------------------------
A0A4W5RVD3_BAX-01      ----------------------------
A0A4W5KP29_BAX-01      ttcacagggagaagtgctgcggccatag
A0A4W5MLR0_BAX-01      ----------------------------
A0A4W5NT98_BAX-01      ----------------------------
                                                   

© 1998-2023Legal notice