Dataset for CDS BCL-2-like of organism Seriola dumerili

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4TX71_BCL2-01      atg---------------------------------------gcgagcga
A0A3B4V9K8_BCL2L1-      atg--tcgtac--------agcaacaga----------------gagct-
A0A3B4TIY6_BCL2L10      atg-----------------------------------------------
A0A3B4V3T1_BCL2L1-      atg--tct-----------caaaacaga----------------gaact-
A0A3B4T8L9_MCL1-01      atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaacta
A0A3B4T8L9_MCL1-02      atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaacta

A0A3B4TX71_BCL2-01      gtataatcgcaatattgtggaaa---------------------------
A0A3B4V9K8_BCL2L1-      ----ggtggagttcttcataagctac------------------------
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      ----ggtcgttttctacataaagcat------------------------
A0A3B4T8L9_MCL1-01      ttgcatttgtcgtcaaaatggaggattggaaacttggaccgacggctccg
A0A3B4T8L9_MCL1-02      ttgcatttgtcgtcaaaatggaggattggaaacttggaccgacggctccg

A0A3B4TX71_BCL2-01      -agtatatctgccataaactc--------------------tccaaacaa
A0A3B4V9K8_BCL2L1-      -aaactgtctcaaagtaactgcccaa---------------cctcactgc
A0A3B4TIY6_BCL2L10      -----------------------------------------tcatgcg--
A0A3B4V3T1_BCL2L1-      -aagctctc--ccagag---------------aaactatcctctcacc--
A0A3B4T8L9_MCL1-01      gagactcctcgccggagattgccattggctctacaatatgttctcacaac
A0A3B4T8L9_MCL1-02      gagactcctcgccggagattgccattggctctacaatatgttctcacaac

A0A3B4TX71_BCL2-01      ggatacgtgtggggatttgatgatgtccgagatgaagatgctgctaataa
A0A3B4V9K8_BCL2L1-      -------tgaggccagaggatgctggtggaaggactgagggagacaaggc
A0A3B4TIY6_BCL2L10      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      ---cacatggaactcaatgagtctcccaacaggactgatggcggggaggc
A0A3B4T8L9_MCL1-01      gggaatgttgtgccaaatgataattctaaacggcccaagagcctggaagt
A0A3B4T8L9_MCL1-02      gggaatgttgtgccaaatgataattctaaacggcccaagagcctggaagt

A0A3B4TX71_BCL2-01      tggctcaatagttgcccctccaccgactttggtccgccggtgccgtgaag
A0A3B4V9K8_BCL2L1-      caactcagctgccagtaatggcttg------------ttggtcaacagca
A0A3B4TIY6_BCL2L10      -------------ggctgtggaaagagacc--------cgggctgtggca
A0A3B4V3T1_BCL2L1-      -------agggttggttgaggaaca------------gcggatagcgacg
A0A3B4T8L9_MCL1-01      cacctcaacaaatgggtatgcaacaaaagcgagtcgggaggacagcgacg
A0A3B4T8L9_MCL1-02      cacctcaacaaatgggtatgcaacaaaagcgagtcgggaggacagcgacg

A0A3B4TX71_BCL2-01      c-caacaccgggcctgacaacgaca-------------------------
A0A3B4V9K8_BCL2L1-      g-tgacaggtgtggtcagcccgggac------------------------
A0A3B4TIY6_BCL2L10      gaggactacctgtatctttgctgcacaagcccacagcca-----------
A0A3B4V3T1_BCL2L1-      cacgccaatggaacttttaatggcacaagtcctgggacccgtgcaga---
A0A3B4T8L9_MCL1-01      t-cgacgacggctctttgccgtgtac---tccggagattcagtcggacgg
A0A3B4T8L9_MCL1-02      t-cgacgacggctctttgccgtgtac---tccggagattcagtcggacgg
                             *        *         *                         

A0A3B4TX71_BCL2-01      ----------gctcacctaacctc--------------------------
A0A3B4V9K8_BCL2L1-      ----------gtcctcgcccccgc----------atggtgg---------
A0A3B4TIY6_BCL2L10      ----------gcccctccacctcccagcgaatcagccgctg---------
A0A3B4V3T1_BCL2L1-      ----------gtccccgcagcggc------agcaacggctg---------
A0A3B4T8L9_MCL1-01      agaaaccgatgtccctagttgtcc------agcaggggatgaagtgttgg
A0A3B4T8L9_MCL1-02      agaaaccgatgtccctagttgtcc------agcaggggatgaagtgttgg
                                  *  *         *                          

A0A3B4TX71_BCL2-01      -------------------------------tgcagacggctctctcagt
A0A3B4V9K8_BCL2L1-      -------------------------------catagag------------
A0A3B4TIY6_BCL2L10      ------------------------------ccatgagaagtatggcccaa
A0A3B4V3T1_BCL2L1-      --------------------------ccgtcaacaacgagc----ctgga
A0A3B4T8L9_MCL1-01      aggacgatacgaggcaacttattagccagtccatgaaaagctttaccgga
A0A3B4T8L9_MCL1-02      aggacgatacgaggcaacttattagccagtccatgaaaagctttaccgga

A0A3B4TX71_BCL2-01      ccgacccgcacgccgagatccacagagtcctgcgcgaggctggagacgaa
A0A3B4V9K8_BCL2L1-      -----------gccgtaa---agtcagcccttaaggactctgctgacgaa
A0A3B4TIY6_BCL2L10      gacatggagacgcagc-----accaggctc-----gcttcc---------
A0A3B4V3T1_BCL2L1-      ----------cgcagtga---aagaggccctccgggattccgccaacgag
A0A3B4T8L9_MCL1-01      cgctcgataccgcggtgg---actgaacacagagcactacaaacaatgaa
A0A3B4T8L9_MCL1-02      cgctcgataccgcggtgg---actgaacacagagcactacaaacaatgaa
                                   ** *      *       *         *          

A0A3B4TX71_BCL2-01      ------cttgagagatt----------ataccagccggacttcacggaga
A0A3B4V9K8_BCL2L1-      ------tttgaattgct----------cttcaaccaagcgtttagtgacc
A0A3B4TIY6_BCL2L10      ---------------------------acacccttgctca------aacc
A0A3B4V3T1_BCL2L1-      ------tttgagttgcg----------atactcccgcgccttcagcgatc
A0A3B4T8L9_MCL1-01      gagggttgtggacggcgttttggaaaaacacagatacgcatacaatggta
A0A3B4T8L9_MCL1-02      gagggttgtggacggcgttttggaaaaacacagatacgcatacaatggta

A0A3B4TX71_BCL2-01      tgtcgcggcagctctatctcacctccaccac------ggcgcagagaaga
A0A3B4V9K8_BCL2L1-      tttccacgcagcttgacatcactcctgacac------tgcataccacagc
A0A3B4TIY6_BCL2L10      ttcgtaacgcagtgt-----gggctggaccc---------ctgctccagc
A0A3B4V3T1_BCL2L1-      tgcacaaccagctgcatatcacgccggccac------agcttaccaaagc
A0A3B4T8L9_MCL1-01      tgatcaacaaactgt------cactggacaacacaggggatgatgtgagg
A0A3B4T8L9_MCL1-02      tgatcaacaaactgt------cactggacaacacaggggatgatgtgagg
                        *           *               *                  ** 

A0A3B4TX71_BCL2-01      ttcgccgaggtgatag----acgaactgttccgggacggggtg---aatt
A0A3B4V9K8_BCL2L1-      tttaagagtgtgatgg----atgagttgttcaaagatggagtc---aact
A0A3B4TIY6_BCL2L10      ctcaggaaggtgatgg----aggagctggtgggagatggacacttgaact
A0A3B4V3T1_BCL2L1-      tttgcgaacgtgatggatgaag----tgttccgggacggcttc---aact
A0A3B4T8L9_MCL1-01      tttgtcggtgcagtag-cgaagagcctgttcgcagatggcaccacaaact
A0A3B4T8L9_MCL1-02      tttgtcggtgcagtag-cgaagagcctgttcgcagatggcaccacaaact
                         *       *   * *    *     ** *    ** **       ** *

A0A3B4TX71_BCL2-01      ggggccggattatcgctttcttcgagttcgggggcacggtg---------
A0A3B4V9K8_BCL2L1-      ggggacgtatagtgggcctatttgcctttgggggtgtactg---------
A0A3B4TIY6_BCL2L10      gggggagggttgtttccattttcacctttactggggtgctggccagactg
A0A3B4V3T1_BCL2L1-      ggggccgcatcatagggctttttgtgttcggcggggcgctg-------tg
A0A3B4T8L9_MCL1-01      ggggtcgcatcgccagcctggtggccttcggggcggtg--g-------tg
A0A3B4T8L9_MCL1-02      ggggtcgcatcgccagcctggtggccttcggggcggtg--g-------tg
                        ****  *  *        *  *    **    *       *         

A0A3B4TX71_BCL2-01      ---------------tgcgttga----------gtgcgcggccaaggagg
A0A3B4V9K8_BCL2L1-      ---------------tgtgtgga--------------atgcatacagaag
A0A3B4TIY6_BCL2L10      ctgctggagcagaaccgtgtgaacccggggctggaccctgggcagggaca
A0A3B4V3T1_BCL2L1-      tgtcgag--------tgtgtgga----------g---------aaggaga
A0A3B4T8L9_MCL1-01      tgtc-ag--------cgcatgaa----------ggagacaggcagggaga
A0A3B4T8L9_MCL1-02      tgtc-ag--------cgcatgaa----------ggagacaggcagggaga
                                        *  *  *                    *  **  

A0A3B4TX71_BCL2-01      ag-atgacatcgcaggtggacaacatcgtggagtggatgacggagtattt
A0A3B4V9K8_BCL2L1-      aatatgagcgagctggtttcccgtatcacagactggatgaccatgtacct
A0A3B4TIY6_BCL2L10      ggggctcggaaactgcaggg--gactggcagagaccatagctgattacct
A0A3B4V3T1_BCL2L1-      ----tgagtcctctggtgggcaggatcgtagagtggatgaccgtctacct
A0A3B4T8L9_MCL1-01      actgtgtggaatctgtggggcagga----------gatctccaaatacct
A0A3B4T8L9_MCL1-02      actgtgtggaatctgtggggcagga----------gatctccaaatacct
                                    * *                     **  *    **  *

A0A3B4TX71_BCL2-01      aaatggacctcttaacagc-----tggataaaggataacggggga----t
A0A3B4V9K8_BCL2L1-      ggatgagcacat---cagtccg--tggatccagagccaaggaggc----t
A0A3B4TIY6_BCL2L10      gggagaa-----gagaagaaagactggct----gctggagaacggtggat
A0A3B4V3T1_BCL2L1-      ggacaaccgcat--tcagcca---tggatccagagtcaaggagga----t
A0A3B4T8L9_MCL1-01      g-----ctgtctgatcagcgagactggct----ggtgaaaaacaactcct
A0A3B4T8L9_MCL1-02      g-----ctgtctgatcagcgagactggct----ggtgaaaaacaactcct
                                        **      *** *                    *

A0A3B4TX71_BCL2-01      gggatgcctttgtggagctgt-----------------atgacagacaga
A0A3B4V9K8_BCL2L1-      gggactgctttgctgagatg-tttgggcaa--gacgccgctgcagaagcg
A0A3B4TIY6_BCL2L10      gggaggggttctgtaaattctccca-----------cagtgccagagagg
A0A3B4V3T1_BCL2L1-      gggagcgctttgctgaaatc-ttcgggcag--gacgcagcagcagagagc
A0A3B4T8L9_MCL1-01      gggatggctttgtagcgttctttcgagtagcagacccagagtctaaagtg
A0A3B4T8L9_MCL1-02      gggatggctttgtagcgttctttcgagtagcagacccagagtctaaagtg
                        ****    **        *                       *  *    

A0A3B4TX71_BCL2-01      gggagtccgtcttcagttgctcctggccctccatcaagacagtcttcggc
A0A3B4V9K8_BCL2L1-      agga----------gatctcgggaagctgt-gatgaag-tggctgctagt
A0A3B4TIY6_BCL2L10      tgagcca-----------------ggactt-------g-tcgatgaagac
A0A3B4V3T1_BCL2L1-      agga----------ggtctcaggagagttt-caagaag-tggctgctggc
A0A3B4T8L9_MCL1-01      aggaacacactcatggcctttgctggatttgcgggaat-cggc-----gc
A0A3B4T8L9_MCL1-02      aggaacacactcatggcctttgctggatttgcgggaat-cggc-----gc
                         *                           *           *        

A0A3B4TX71_BCL2-01      ctggctgcac----tcggggcagcgagcctcacc----------------
A0A3B4V9K8_BCL2L1-      tggagtggca----atgttggcaggagtgctgat----------------
A0A3B4TIY6_BCL2L10      agcactgtttgctgctgctggtgtgggcctcgct----------------
A0A3B4V3T1_BCL2L1-      ggggatgacc----ctggtgaccggggttgtggt----------------
A0A3B4T8L9_MCL1-01      aacactggcc----ctgttgatcag-------------------------
A0A3B4T8L9_MCL1-02      aacactggcc----ctgttgatcaggtgtttgtttgagcggtccaggcca
                             **         *  *    *                         

A0A3B4TX71_BCL2-01      -------atcggagcataccttacacagaagtga----------------
A0A3B4V9K8_BCL2L1-      ---------gggcgtgctcatcgttaagaaacattaa-------------
A0A3B4TIY6_BCL2L10      ---------ggactcacc-tttctcctggtgcgctag-------------
A0A3B4V3T1_BCL2L1-      ---------gggctcactgattgcccaaaagcgcc-------tgtga---
A0A3B4T8L9_MCL1-01      -------------------------------cgccatga---tgtga---
A0A3B4T8L9_MCL1-02      aagcaggaagggaaaattgcattttttccaatgtcatgcagtcgtgaagc

A0A3B4TX71_BCL2-01      -------------------------
A0A3B4V9K8_BCL2L1-      -------------------------
A0A3B4TIY6_BCL2L10      -------------------------
A0A3B4V3T1_BCL2L1-      -------------------------
A0A3B4T8L9_MCL1-01      -------------------------
A0A3B4T8L9_MCL1-02      ccatttccatagagctcattcataa

© 1998-2020Legal notice