Dataset for CDS BCL-2-like of organism Panthera tigris altaica

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C9K7H4_MCL1-01      atgtttggcctca------------------agagaaacgctgtaatcgg
A0A8C9KZ34_BCL2A1-      atggcggatggcg----------------------------agt--ttgg
A0A8C9KZ34_BCL2A1-      atggcggatggcg----------------------------agt--ttgg
A0A8C9J3W6_BCL2-01      atggcgcacgctgggagaacagggtatgacaaccgggagatagtcatgaa
A0A8C9J3S1_BCL2L2-      atggcgaccccag---cctcagccccagacacacgggctctagtggcaga
A0A8C9M2S8_BCL2L1-      at----------g---tctcag-----agcaaccgggagctggtggttga
                        **                                        **      

A0A8C9K7H4_MCL1-01      actcaacctctactgtgggggggccgggctggcggccgggagcggcggcg
A0A8C9KZ34_BCL2A1-      gtacgttctc---------------acgctggccc---gggactat----
A0A8C9KZ34_BCL2A1-      gtacgttctc---------------acgctggccc---gggactat----
A0A8C9J3W6_BCL2-01      gtacatccacta------------taagctgtcgcagaggggctac----
A0A8C9J3S1_BCL2L2-      ctttgtaggcta------------taagctgaggcagaagggttat----
A0A8C9M2S8_BCL2L1-      ctttctctccta------------caagctttcccagaaaggatacagct
                                 *                 ***                    

A0A8C9K7H4_MCL1-01      cctccgcgactggcgccaaggacgcga-----------------------
A0A8C9KZ34_BCL2A1-      -----------------acgaagcac------------------------
A0A8C9KZ34_BCL2A1-      -----------------acgaagcac------------------------
A0A8C9J3W6_BCL2-01      -----gagtgggatgccggggacgcgagnnnnnnnnnnnnnnnnnnnnnn
A0A8C9J3S1_BCL2L2-      -------gtt------tgtggagcag------------------------
A0A8C9M2S8_BCL2L1-      ggagtcagtttagtgatgtggaagagaacagaactgaggccccagaaggg
                                           * *                            

A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C9J3W6_BCL2-01      nnnnnngccg----------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      actgaatcggagatggagacccccagtgccatcaatggcaacccatcctg

A0A8C9K7H4_MCL1-01      --aaccactgggcgggtctggggcgg------------------------
A0A8C9KZ34_BCL2A1-      --------------gttctgcagggg------------------------
A0A8C9KZ34_BCL2A1-      --------------gttctgcagggg------------------------
A0A8C9J3W6_BCL2-01      --ccgccgccgcgggccctgcgctca------------------------
A0A8C9J3S1_BCL2L2-      --------------gccctggggagg------------------------
A0A8C9M2S8_BCL2L1-      gcacttggcggacagccctgcggtgaatggagccactggccacagcagca
                                      *  ***                              

A0A8C9K7H4_MCL1-01      ----------ccagcc--------------gaaaggcgttagagaccctc
A0A8C9KZ34_BCL2A1-      --------ccccagcccgggtgccacccaagcagagtatcccaagtgcta
A0A8C9KZ34_BCL2A1-      --------ccccagcccgggtgccacccaagcagagtatcccaagtgcta
A0A8C9J3W6_BCL2-01      --------gccc------tgtgccac----ctgtggtccacctgaccctg
A0A8C9J3S1_BCL2L2-      --------gcccagcagctgacccac----------tgcaccaagccatg
A0A8C9M2S8_BCL2L1-      gcttggatgcccgggaggtgatccccatggcagcggtgaagcaggcgctg
                                  **                                    * 

A0A8C9K7H4_MCL1-01      cgacggg-------------tcggggacggcgtgcagcgcaaccacgaga
A0A8C9KZ34_BCL2A1-      caagacgtggccttctcggtccagggggaggtcgagaagcagctgaagcc
A0A8C9KZ34_BCL2A1-      caagacgtggccttctcggtccagggggaggtcgagaagcagctgaagcc
A0A8C9J3W6_BCL2-01      cgccagg-------------ccggcgatgacttctcccgtcgctaccgcc
A0A8C9J3S1_BCL2L2-      cgtgcag-------------ctggagatgagtttgagacccgcttccggc
A0A8C9M2S8_BCL2L1-      agggagg-------------ccggggatgagtttgaactgaggtaccggc
                              *                * *                        

A0A8C9K7H4_MCL1-01      ccgccttccaaggcatgcttcggaaactggacatcaaaaacgaagacg--
A0A8C9KZ34_BCL2A1-      gtgcct-------------ggacaagttccacgtggggtcggtagacacg
A0A8C9KZ34_BCL2A1-      gtgcct-------------ggacaagttccacgtggggtcggtagacacg
A0A8C9J3W6_BCL2-01      gcgacttcgcggagatgtccagccagctgcacctgacacccttt---acc
A0A8C9J3S1_BCL2L2-      gcaccttctctgatttggcagcccagttgcatgtgacccctggg---tca
A0A8C9M2S8_BCL2L1-      gggcattcagcgacctgacatcccagcttcacatcaccccaggg---aca
                             *                  *  *  *  *                

A0A8C9K7H4_MCL1-01      --atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggag
A0A8C9KZ34_BCL2A1-      gccaggacgatgttccac-caagtgatggagaaggaatttgaagacggca
A0A8C9KZ34_BCL2A1-      gccaggacgatgttccac-caagtgatggagaaggaatttgaagacggca
A0A8C9J3W6_BCL2-01      gcaaggggacgctttgcc-acggtggtggaggagctcttcagggatgg--
A0A8C9J3S1_BCL2L2-      gcccagcaacgcttcacc-caggtctctgatgaactcttccaaggggg--
A0A8C9M2S8_BCL2L1-      gcatatcagagctttgag-caggtagtgaacgaactcttccgggatgg--
                                    **        **        *    **    *  **  

A0A8C9K7H4_MCL1-01      taacaaactggggcaggattgtgactcttatttcttttggtgcctttgtg
A0A8C9KZ34_BCL2A1-      tcatcaactggggcaggattgtgactatatttgcgtttgagggcatcct-
A0A8C9KZ34_BCL2A1-      tcatcaactggggcaggattgtgactatatttgcgtttgagggcatcct-
A0A8C9J3W6_BCL2-01      -agtgaactgggggaggattgtggccttctttgagttcggtggggtcatg
A0A8C9J3S1_BCL2L2-      -ccccaactggggccgccttgtggccttctttgtctttggagccgcactg
A0A8C9M2S8_BCL2L1-      -ggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
                             ********  *  ***** *  *  *    ** *  *      * 

A0A8C9K7H4_MCL1-01      gccaaacacttgaagagtataaaccaagaaagctgcatc-gaaccattag
A0A8C9KZ34_BCL2A1-      --------catcaagaagcttctccaggagcggatcgtcccagacgcgga
A0A8C9KZ34_BCL2A1-      --------catcaagaagcttctccaggagcggatcgtcccagacgcgga
A0A8C9J3W6_BCL2-01      ------tgtgtggagagcgtcaaccgagagatg-------tcgcccctgg
A0A8C9J3S1_BCL2L2-      ------tgtgctgagagtgtcaacaaggagatg-------gagccacttg
A0A8C9M2S8_BCL2L1-      ------tgcgtggaaagcgtagacaaggagatg-------caggtattgg
                                     * *   *   *   **                     

A0A8C9K7H4_MCL1-01      caga--aagcatcacagat-----------gttcttgtaaggacaaa-ac
A0A8C9KZ34_BCL2A1-      tgcgttcaaggtttcctacttcgttgccgagttcatcacgaaacacacgg
A0A8C9KZ34_BCL2A1-      tgcgttcaaggtttcctacttcgttgccgagttcatcacgaaacacacgg
A0A8C9J3W6_BCL2-01      tgga--caacatcgccctgtggatgactgagtacctgaaccggcacctgc
A0A8C9J3S1_BCL2L2-      tggg--acaagtgcaagagtggatggtggcctacctggagacacggctgg
A0A8C9M2S8_BCL2L1-      tgag--tcggatcgcaacttggatggccacttacctgaacgaccacctag
                                   *                   * * *       *      

A0A8C9K7H4_MCL1-01      gagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
A0A8C9KZ34_BCL2A1-      gagaatggatccggcaaaacggaggctgggaaaacggctttgtaaggaag
A0A8C9KZ34_BCL2A1-      gagaatggatccggcaaaacggaggctgg--aggcgtttcc-----gaag
A0A8C9J3W6_BCL2-01      acacctggatccaagacaacggaggctggg--------------------
A0A8C9J3S1_BCL2L2-      ccgactggatccacagcagtgggggctgggcggagttcacagctctatac
A0A8C9M2S8_BCL2L1-      agccttggatccaggagaacggcggctgggacacttttgtggaactctac
                             *** *           * ******                     

A0A8C9K7H4_MCL1-01      cacgtagaggacctagaaggtg----------------------------
A0A8C9KZ34_BCL2A1-      ttcgaa-cccaagt--ctggctggctgacctttctggaagttacaggaaa
A0A8C9KZ34_BCL2A1-      tgtgaagcacaagcagcgaggggacagaacctccctga------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      ggggacggggccctggaggaggcgcggcgtctgcgggagggg--aactgg
A0A8C9M2S8_BCL2L1-      gggaacaatgcagcggccgaga----------gccggaagggccaggagc

A0A8C9K7H4_MCL1-01      gcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagct
A0A8C9KZ34_BCL2A1-      gatctgtaaggtattgtctctcctgaagaactactactga----------
A0A8C9KZ34_BCL2A1-      ---------------gtctctc----acatcctctgcttcgttag-----
A0A8C9J3W6_BCL2-01      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      gcctcagtgaggacag-----tgctgacaggggccgtggcactgggggcc
A0A8C9M2S8_BCL2L1-      gcttca------accgctggttcctgacagg---catgactgtggctggc

A0A8C9K7H4_MCL1-01      ------------ggtttggcatatctaataagatag
A0A8C9KZ34_BCL2A1-      ------------------------------------
A0A8C9KZ34_BCL2A1-      ------------------------------------
A0A8C9J3W6_BCL2-01      ----------taggtgca------------------
A0A8C9J3S1_BCL2L2-      ctggtaactgtaggggccttttttgctagcaagtga
A0A8C9M2S8_BCL2L1-      gtggttctgctgggctcactcttcagtcggaaatga

© 1998-2023Legal notice