Dataset for CDS BCL-2-like of organism Panthera tigris altaica

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C9J3S1_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagcaggccctggggagggcccagcagctgacccactgcaccaagccatgcgtgcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C9J3W6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL-2 (length=498 residues).
atggcgcacgctgggagaacagggtatgacaaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgagnnnnnnnnnnnnnnnnnnnnnnnnnnnngccgccgccgccgcgggccctgcgc
tcagccctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttc
gcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcag
ggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgagaga
tgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaagacaac
ggaggctgggtaggtgca
>gnl|bcl2dbcds|A0A8C9K7H4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Panthera tigris altaica GN=MCL-1 (length=573 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggctggcggccgggagcggcgg
cgcctccgcgactggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccac
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C9KZ34_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2A1 (length=525 residues).
atggcggatggcgagtttgggtacgttctcacgctggcccgggactatacgaagcacgttctgcaggggccccagcccgg
gtgccacccaagcagagtatcccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaagcagctgaagc
cgtgcctggacaagttccacgtggggtcggtagacacggccaggacgatgttccaccaagtgatggagaaggaatttgaa
gacggcatcatcaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgttcaaggtttcctacttcgttgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaagtctggctggctgacctttctggaagttaca
ggaaagatctgtaaggtattgtctctcctgaagaactactactga
>gnl|bcl2dbcds|A0A8C9KZ34_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2A1 (length=495 residues).
atggcggatggcgagtttgggtacgttctcacgctggcccgggactatacgaagcacgttctgcaggggccccagcccgg
gtgccacccaagcagagtatcccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaagcagctgaagc
cgtgcctggacaagttccacgtggggtcggtagacacggccaggacgatgttccaccaagtgatggagaaggaatttgaa
gacggcatcatcaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgttcaaggtttcctacttcgttgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctggaggcgtttccgaagtgtgaagcacaagcagcgaggggacagaacctccctgagtctctcacat
cctctgcttcgttag
>gnl|bcl2dbcds|A0A8C9M2S8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
© 1998-2022Legal notice