Dataset for CDS BCL-2 of organism Oncorhynchus kisutch

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C7CHJ0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=693 residues).
atgatggcaaacgataatccttataacagtcgctttattgttgaaaaatacatacatcacaaactgttgaagaagggatt
tgtatgggaattttatccagaaaacgattccccaaataatggttttggggagccctctccccctaactcccctgaagttt
ttgcacggaggtcccaaccctccgccgaaggcgtggacactgactctccgctccaaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacggcacagagaaggtttactgctgttatagaggagctcttcagcgacggtgtaa
actggggtcggattgtggctttctttgaatttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggga
cgcctttgtggagatctatgggcagcagaggatctctgccttccactcctggccctacctaaagacagtgttcggcctgg
ccgccctgggtgcagccggagtcaccattggagccttgttcatccagaagtga
>gnl|bcl2dbcds|A0A8C7G8X1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgccgaggaggaggaaggtgctgctaataatgggtcgatgatttctcctcggccgggtttggcacggcggtgcc
acggggccaataacggcggaccgggcagcgtccctagtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgactttgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggaggcttttgttga
gctctatgacagacagagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A8C7N3I9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=675 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttggcacggcggtgccacggag
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtcg
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatgacggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctcta
tgacagacagagggactccgtgttcggttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaa
gccttaccatcggagcttaccttacacagaagtga
© 1998-2022Legal notice