Dataset for CDS BCL-2 of organism Oncorhynchus kisutch

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7CHJ0_BCL2-01      atgatggcaaacgataatccttataacagtcgctttattgttgaaaaata
A0A8C7G8X1_BCL2-01      ---atggcaaacg---------acgacaaccgctttatagtggaaaagta
A0A8C7N3I9_BCL2-01      ---atggcaaacg---------acgacaaccgctgtatagtggaaaagta
                           **********         *  ***  **** *** ** ***** **

A0A8C7CHJ0_BCL2-01      catacatcacaaactgttgaagaagggatttgtatgggaattt-----ta
A0A8C7G8X1_BCL2-01      catttgtcacaaactcttgaaacgaggatatgcgtgggatttcgaggatg
A0A8C7N3I9_BCL2-01      catttgtcacaaactcttgaaaaggggatatgcgtgggatttcgagaatg
                        ***   ********* *****    **** **  ***** **      * 

A0A8C7CHJ0_BCL2-01      tcca----gaaaacgattccccaaataatggttttggggagccctctccc
A0A8C7G8X1_BCL2-01      ccgaggaggaggaaggtgctgctaataatgggtcgatgatttctcctcgg
A0A8C7N3I9_BCL2-01      cc------gaggaagatgctgataataatgggtcgatgatttctcctccg
                         *      **  * * * *    ******** *    *    *  ***  

A0A8C7CHJ0_BCL2-01      cctaactcccctgaagtttttgcacggaggtccca---accctccgccga
A0A8C7G8X1_BCL2-01      ccg------------ggtttggcacggcggtgccacggggccaataacgg
A0A8C7N3I9_BCL2-01      cct------------ggtttggcacggcggtgccacggagccaataacgc
                        **             * *** ****** *** ***     **     ** 

A0A8C7CHJ0_BCL2-01      aggcgtggacactgactctccgctccaaaacaggatcccgcaaccggacc
A0A8C7G8X1_BCL2-01      cggaccgggcagcgtccctagtctttccaaatggctctcccaaccggacc
A0A8C7N3I9_BCL2-01      cagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacc
                          *   ** **  * * *    **    **  ** ** * *** ******

A0A8C7CHJ0_BCL2-01      gacatgcccggctccatagggtgctgcgcgaggcgggggacgagattgaa
A0A8C7G8X1_BCL2-01      cgcatgcagctattcacagagttttgcgtgaggccggggacgaactcgaa
A0A8C7N3I9_BCL2-01      cgcatgcagctattcacagagttttgcgtgaggccggggacgaactcgaa
                          *****     * ** ** **  **** ***** ********  * ***

A0A8C7CHJ0_BCL2-01      ataatgtatcagcgggactttgcagagatgtcggggcagttgcattttac
A0A8C7G8X1_BCL2-01      agactgtaccagcccgactttgcagagatgtcacaccagctgtatctcac
A0A8C7N3I9_BCL2-01      cgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
                          * **** ****  ******** ********    **  ** ** * **

A0A8C7CHJ0_BCL2-01      gcccagtacggcacagagaaggtttactgctgttatagaggagctcttca
A0A8C7G8X1_BCL2-01      atcctccacggctgagaggagatttagagaggtgatagacgagctgttca
A0A8C7N3I9_BCL2-01      gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttca
                          *    * ***  * ** ** ** *  *  ** ***** ***** ****

A0A8C7CHJ0_BCL2-01      gcgacggtgtaaactggggtcggattgtggctttctttgaatttggaggg
A0A8C7G8X1_BCL2-01      gggatggggttaactggggacggattatcgccttcttcgagttcgggggc
A0A8C7N3I9_BCL2-01      gggacggggttaactggggacgaattgtcgccttcttcgagttcggtggc
                        * ** ** ** ******** ** *** * ** ***** ** ** ** ** 

A0A8C7CHJ0_BCL2-01      acaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtagacaa
A0A8C7G8X1_BCL2-01      acaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatca
A0A8C7N3I9_BCL2-01      acaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgacca
                        ***** ** *****  **** ***  *** ******** ***** **  *

A0A8C7CHJ0_BCL2-01      cattgcccattggatgacagagtacctgaacggacccctgcagaactgga
A0A8C7G8X1_BCL2-01      catcgcggtgtggatgacagagtatctaaatggaccactgctcaactgga
A0A8C7N3I9_BCL2-01      catcgccgggtggatgacggagtatctaaatggaccgctgcacaactgga
                        *** **    ******** ***** ** ** ***** ****  *******

A0A8C7CHJ0_BCL2-01      tccaggagaatggtgactgggacgcctttgtggagatctatgggcagcag
A0A8C7G8X1_BCL2-01      ttcaggagaacgggggatgggaggcttttgttgagctctatgacagacag
A0A8C7N3I9_BCL2-01      ttcaagagaacgggggatgggaggcctttgttgagctctatgacagacag
                        * ** ***** ** *  ***** ** ***** *** ******     ***

A0A8C7CHJ0_BCL2-01      aggatctctgccttccactcctggccctacctaaagacagtgttcggcct
A0A8C7G8X1_BCL2-01      agggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcct
A0A8C7N3I9_BCL2-01      agggactccgtgttcggttcatggccgtccatcaagactgtctttggcct
                        ***  *** *  ***   ** ***** * * * ***** ** ** *****

A0A8C7CHJ0_BCL2-01      ggccgccctgggtgcagccggagtcaccattggagccttgttcatccaga
A0A8C7G8X1_BCL2-01      ggctgcactgggggccgcaagccttaccatcggagcataccttacacaga
A0A8C7N3I9_BCL2-01      ggctgcactgggggccgcaagccttaccatcggagcttaccttacacaga
                        *** ** ***** ** **  *  * ***** ***** *   * *  ****

A0A8C7CHJ0_BCL2-01      agtga
A0A8C7G8X1_BCL2-01      agtga
A0A8C7N3I9_BCL2-01      agtga
                        *****

© 1998-2022Legal notice