Dataset for CDS BCL-2-like of organism Spermophilus dauricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9QEN4_MCL1-01      at-----------gttcggccttaagaggaacgc-------ggtcatcgg
A0A8C9PIV7_BCL2A1-      at----------------------gaatgactgtgagttcaggt------
A0A8C9PGU3_BCL2L2-      atggcgaccccagcctcggccccaga-cacacgggctct--ggtggccga
A0A8C9UNM3_BCL2L1-      at----------------gtctcagagcaaccgggagct--ggtggttga
                        **                              *        ***      

A0A8C9QEN4_MCL1-01      actcaacctctact------------------------------------
A0A8C9PIV7_BCL2A1-      -----tcatccacacgctggctcagga-----ctacctgcagcacgt---
A0A8C9PGU3_BCL2L2-      ctttgtaggctataagctgaggcagaagggttatgtct------------
A0A8C9UNM3_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
                                 * *                                      

A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A8C9PIV7_BCL2A1-      -----------------------------cctgcaggtaccgcaacgtgg
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      gcgatgtggaagagaacaggactgaagccccagaagggactgaatcagag
                                                                          

A0A8C9QEN4_MCL1-01      gcgggggcgc--------------------------------cgggct--
A0A8C9PIV7_BCL2A1-      gtcaagtc----------------------------------ccagc---
A0A8C9PGU3_BCL2L2-      gtggag------------------------------------ctggcc--
A0A8C9UNM3_BCL2L1-      gtggagacccccagtgccatcaatggcaacccatcctggcatctggccga
                        *    *                                    *  **   

A0A8C9QEN4_MCL1-01      -------------------------------------------gggggcc
A0A8C9PIV7_BCL2A1-      -----------------------------------------aaaacgtcc
A0A8C9PGU3_BCL2L2-      -----------------------ctgg--------------ggagggccc
A0A8C9UNM3_BCL2L1-      cagccccgcggtaaatggagccactggtcacagcagcagtttggatgccc
                                                                      * **

A0A8C9QEN4_MCL1-01      agcggcggcatgcttc----------------------------ggaagc
A0A8C9PIV7_BCL2A1-      a--aag----tgttacaaaacgtggcttt---ctcagtccaaaaagaagt
A0A8C9PGU3_BCL2L2-      agcagc----tgatccac----------tgcaccaagccatgcgggcagc
A0A8C9UNM3_BCL2L1-      gggagg----tgatccccatggcagcagtgaagcaagcattgagggaggc
                                  ** * *                             *  * 

A0A8C9QEN4_MCL1-01      tggaca----tcaaaaacgagga----------------tgatgtcaagt
A0A8C9PIV7_BCL2A1-      tgaaaa-gaatctgaaacc--atacttggacaattt---tgatgtggtgt
A0A8C9PGU3_BCL2L2-      tggagatgagttcgagacccgcttccggcgcaccttctctgatctggcag
A0A8C9UNM3_BCL2L1-      aggcgacgagtttgaactgcggtaccggcgggcattcagtgacctgacgt
                         *   *    *   *                        ***  *     

A0A8C9QEN4_MCL1-01      ctctgtctcgc------------------------------------gtg
A0A8C9PIV7_BCL2A1-      ct--gctg-atactgc--------cagaacaata----ttcaatcaagtg
A0A8C9PGU3_BCL2L2-      ctcagctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtc
A0A8C9UNM3_BCL2L1-      cccagctccacatcaccccggggacagcgtatcagagctttgaacaggta
                        *   *                                          ** 

A0A8C9QEN4_MCL1-01      atggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A8C9PIV7_BCL2A1-      atggaaaaggaatttgaagatggcatcatgaactggggaaggattgtgac
A0A8C9PGU3_BCL2L2-      tctgacgaacttttccaagggggtccc---aactggggtcgtcttgtggc
A0A8C9UNM3_BCL2L1-      gtgaacgaactcttccgggatggggta---aactggggtcgcattgtggc
                               *    **    *  **       ********  *  ***** *

A0A8C9QEN4_MCL1-01      tctcatttcttttggtgc--ctttgtggccaaacacttgaagagcataaa
A0A8C9PIV7_BCL2A1-      catatttgccttcggaggagttctg-g--------tcaagaaacttctgc
A0A8C9PGU3_BCL2L2-      cttctttgtctttggggctgccctgtg--------tgctgagagtgtcaa
A0A8C9UNM3_BCL2L1-      ctttttctccttcggcggggcactgtg--------cgtggaaagcgtaga
                          *  *    ** ** *      ** *             * *       

A0A8C9QEN4_MCL1-01      ccaagaaagctgca-----ttgaacccttagcagaaagtatcacagacgt
A0A8C9PIV7_BCL2A1-      gagagaggattgcccctgctgtggattccgacgagg-ggatctcttactt
A0A8C9PGU3_BCL2L2-      caaagaga-----------tggagccactggtgggacaagtgcaggagtg
A0A8C9UNM3_BCL2L1-      caaggaga-----------tgcaggtattggtgagtcggatcgcaagttg
                            **             *                    *         

A0A8C9QEN4_MCL1-01      gctcgt----------aaggacaaaacgg--gactggctggtcaaacaaa
A0A8C9PIV7_BCL2A1-      tgtggctgagttcattatgaataatgcaggagaatggataaggcaaaatg
A0A8C9PGU3_BCL2L2-      gatggtggcctacctggagacgcggctggctgactggatccacagcagtg
A0A8C9UNM3_BCL2L1-      gatggccacttacctgaatgaccacctagagccttggatccaggagaacg
                          * *                       *     *** *           

A0A8C9QEN4_MCL1-01      gaggctgggatgggtttgtggagttcttccatgtagaggacctagaag--
A0A8C9PIV7_BCL2A1-      gaggctgggaaa-----atggctttgtaaagaagtttgaacctaa-----
A0A8C9PGU3_BCL2L2-      ggggctgggcggagttcacagctctatacggggacggggccctggaggag
A0A8C9UNM3_BCL2L1-      gcggctgggacacttttgtggaactctacgggaataatgcggcagcagag
                        * *******           *   * *                       

A0A8C9QEN4_MCL1-01      ------------------------gcggcatcagaaatgtg----ctgct
A0A8C9PIV7_BCL2A1-      -----------------------------atctggctggttgacttttct
A0A8C9PGU3_BCL2L2-      gcacggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgac
A0A8C9UNM3_BCL2L1-      agccgg-----aagggccaggagcgcttcaaccgttggttc----ctgac
                                                     * * *            *   

A0A8C9QEN4_MCL1-01      ggctttcgcaggtgttgctggcgtag--------gagctggtttggcata
A0A8C9PIV7_BCL2A1-      gggagttacag----ggcagatctgt--------gagatgctgtctctcc
A0A8C9PGU3_BCL2L2-      gggggccgtggcactgggggccctggtaactgtaggggccttttttgcta
A0A8C9UNM3_BCL2L1-      ggg---catgactgtggccggcgtggttctgctgggctcgcttttcagtc
                        **              *  *   *          *      * *      

A0A8C9QEN4_MCL1-01      tctaataagatag
A0A8C9PIV7_BCL2A1-      tgaagcaa-----
A0A8C9PGU3_BCL2L2-      gcaagtga-----
A0A8C9UNM3_BCL2L1-      ggaaatga-----
                           *   *     

© 1998-2023Legal notice