Dataset for CDS BCL-2-like of organism Spermophilus dauricus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C9PGU3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Spermophilus dauricus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C9PIV7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Spermophilus dauricus GN=BCL2A1 (length=519 residues).
atgaatgactgtgagttcaggttcatccacacgctggctcaggactacctgcagcacgtcctgcaggtaccgcaacgtgg
gtcaagtcccagcaaaacgtccaaagtgttacaaaacgtggctttctcagtccaaaaagaagttgaaaagaatctgaaac
catacttggacaattttgatgtggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcatgaactggggaaggattgtgaccatatttgccttcggaggagttctggtcaagaaacttctgcgagagag
gattgcccctgctgtggattccgacgaggggatctcttactttgtggctgagttcattatgaataatgcaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggttgacttttctgggagtt
acagggcagatctgtgagatgctgtctctcctgaagcaa
>gnl|bcl2dbcds|A0A8C9QEN4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Spermophilus dauricus GN=MCL-1 (length=441 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcggcat
gcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacggag
taacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaa
agctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtcaaacaaagagg
ctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttcgcaggtg
ttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C9UNM3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Spermophilus dauricus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
© 1998-2023Legal notice