Dataset for CDS BCL-2-like of organism Acanthochromis polyacanthus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      atgttccgacggcacgtgaaggcgtcatattacgtaatagggaggcaggg

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ccgagcggacgtaggaggatacgtgcgagcacacacactcgtgaacacaa

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      -----atgaatatgattcctacgaagaggacgacgctgatgaactgctta
A0A3Q1EQB9_MCL1-02      -----atgaatatgattcctacgaagaggacgacgctgatgaactgctta
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agtggatgtgtgacattcttgtggagcttgacagctttttgtgcgcaccg

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      atctttccgcaaaatg----------------------------------
A0A3Q1EQB9_MCL1-02      atctttccgcaaaatg----------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agcgacagacggactggagacagcgtcacggagcggaggacagcttcccg

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ggaatcccgtgcttttgtttcggttcttgctgggcctgagctggtttgtc

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agccttgtgtaggtttggttttcacccccgagcgtcctgtggatatcagc

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ggaccatggtggtctgagcagagggcagcaggaaggcagcctggcacagt

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      gtgtgttcactctaacgcagcgagacggaccagagccacgaggacggaaa

A0A3Q1FLK7_BCL2-01      -----------------atggcg------aacgagtgtaatcgcaatatt
A0A3Q1GM98_BCL2L10      -----------------atgtcctgtgg----------------gctatg
A0A3Q1EQB9_MCL1-01      -----------------gagtcgtggagggaccgatgcactatggatccg
A0A3Q1EQB9_MCL1-02      -----------------gagtcgtggagggaccgatgcactatggatccg
A0A3Q1EVP6_BCL2L1-      -----------------atgtcgtgcagtaacaga---------gagctg
A0A3Q1FR00_BCL2L1-      -----------------atgtc--tcag-aacaga---------gaactg
A0A3Q1FR00_BCL2L1-      acacattggcacgcaacatgtc--tcag-aacaga---------gaactg
                                           * *                            

A0A3Q1FLK7_BCL2-01      g-----------------------tagaaaagtacatctgccataaactc
A0A3Q1GM98_BCL2L10      g-------------------------------------------------
A0A3Q1EQB9_MCL1-01      gagattcctccccgcagatttccgtggcctcctctatagat---------
A0A3Q1EQB9_MCL1-02      gagattcctccccgcagatttccgtggcctcctctatagat---------
A0A3Q1EVP6_BCL2L1-      g-----------------------tggagttctttataagctacaagctg
A0A3Q1FR00_BCL2L1-      g-----------------------tggttttctacataaagtataaactg
A0A3Q1FR00_BCL2L1-      g-----------------------tggttttctacataaagtataaactg

A0A3Q1FLK7_BCL2-01      tccaaacggggctacgtgtgg-----------------------------
A0A3Q1GM98_BCL2L10      ----aaagagactgt------------------------ggtcctggcag
A0A3Q1EQB9_MCL1-01      cctcaaaacgggaatct--tggctccagtgataccccaaaacggccgaag
A0A3Q1EQB9_MCL1-02      cctcaaaacgggaatct--tggctccagtgataccccaaaacggccgaag
A0A3Q1EVP6_BCL2L1-      tctcaaaggaactatccgatgtctctgctgaggccagaggatgctggagg
A0A3Q1FR00_BCL2L1-      tcccagagaaactatcc----cctc------aaccacatggtgctgaacg
A0A3Q1FR00_BCL2L1-      tcccagagaaactatcc----cctc------aaccacatggtgctgaacg

A0A3Q1FLK7_BCL2-01      -----------gggtttgatgatgtccgggatgaagatgct--gctaata
A0A3Q1GM98_BCL2L10      -----------aggactacctgtccctgtgctgtgcaggcccacatcaag
A0A3Q1EQB9_MCL1-01      aacct------gggagtgaacgggtatgcgccaaaaagccttcgacaaga
A0A3Q1EQB9_MCL1-02      aacct------gggagtgaacgggtatgcgccaaaaagccttcgacaaga
A0A3Q1EVP6_BCL2L1-      a----------aggactgatgggg---------acaaggcc---------
A0A3Q1FR00_BCL2L1-      aggctcccaacaggactgatgggg---------gggaggcccggctggga
A0A3Q1FR00_BCL2L1-      aggctcccaacaggactgatgggg---------gggaggcccggctggga
                                    **  *                   *  *          

A0A3Q1FLK7_BCL2-01      acgggtcagtagttgaccctccgccgactttggtccgtcggtgccatgaa
A0A3Q1GM98_BCL2L10      cccctccac--------ctcccag--------------------------
A0A3Q1EQB9_MCL1-01      cagcgacag--------tatggag-gacggctctttaccgtgcaccccag
A0A3Q1EQB9_MCL1-02      cagcgacag--------tatggag-gacggctctttaccgtgcaccccag
A0A3Q1EVP6_BCL2L1-      --agctcag--------cctccag----------------------taac
A0A3Q1FR00_BCL2L1-      gaggaccag--------cggacagagacacacgccaacgggacttttaac
A0A3Q1FR00_BCL2L1-      gaggaccag--------cggacagagacacacgccaacgggacttttaac

A0A3Q1FLK7_BCL2-01      gccagcaccgggcccgacaacgagagcgacccccacct------------
A0A3Q1GM98_BCL2L10      --------cgagtc------------------------------------
A0A3Q1EQB9_MCL1-01      agct----ccagtcggacagtgaaaccgacgtctccagttgtccaacagg
A0A3Q1EQB9_MCL1-02      agct----ccagtcggacagtgaaaccgacgtctccagttgtccaacagg
A0A3Q1EVP6_BCL2L1-      ggc-----------------------------------------------
A0A3Q1FR00_BCL2L1-      ggca----cgagtcccgggacccccccgccgtccccg-------------
A0A3Q1FR00_BCL2L1-      ggca----cgagtcccgggacccccccgccgtccccg-------------

A0A3Q1FLK7_BCL2-01      -------ctgcagacggctcccccagtccgacccgcacgctgccatccac
A0A3Q1GM98_BCL2L10      -----agccgctg-------ccatgaggcgtct-----------------
A0A3Q1EQB9_MCL1-01      ggacgagttgctggagaatgacacgaggcaactcattcgccgtttcttaa
A0A3Q1EQB9_MCL1-02      ggacgagttgctggagaatgacacgaggcaactcattcgccgtttcttaa
A0A3Q1EVP6_BCL2L1-      -------ttgctggtgaacaaca-gagacggcatagaggctg-----taa
A0A3Q1FR00_BCL2L1-      ----cggcggctggcg-tcgacg-gcgac--catggacgcag-----tga
A0A3Q1FR00_BCL2L1-      ----cggcggctggcg-tcgacg-gcgac--catggacgcag-----tga
                                 ** *        *      *  *                  

A0A3Q1FLK7_BCL2-01      ag----------agtcctgcgggaggctgg----------ggatgaact-
A0A3Q1GM98_BCL2L10      ------------ggccc---aagacatgg-----------agaagcagca
A0A3Q1EQB9_MCL1-01      gagactttactggactttcaaagccccggtggaatgaaagcaaagcatta
A0A3Q1EQB9_MCL1-02      gagactttactggactttcaaagccccggtggaatgaaagcaaagcatta
A0A3Q1EVP6_BCL2L1-      aatc--------cacccttaaggatgcggc----------agatgaatt-
A0A3Q1FR00_BCL2L1-      agga--------ggccctccgggacacggc----------caacgagtt-
A0A3Q1FR00_BCL2L1-      agga--------ggccctccgggacacggc----------caacgagtt-
                                              *     *             * *     

A0A3Q1FLK7_BCL2-01      -------------------tgaaagactgtaccagccggacttcacggag
A0A3Q1GM98_BCL2L10      c------------------caggctcgcttccactccctcactcaggcct
A0A3Q1EQB9_MCL1-01      tcaacaatgaaaagagtggtggatgacgttttggacaaaca--cagatac
A0A3Q1EQB9_MCL1-02      tcaacaatgaaaagagtggtggatgacgttttggacaaaca--cagatac
A0A3Q1EVP6_BCL2L1-      -------------------tgaacttctcttcacgcaaactttcagtgac
A0A3Q1FR00_BCL2L1-      -------------------cgagctgcggtacgcccgcgccttcagcgac
A0A3Q1FR00_BCL2L1-      -------------------cgagctgcggtacgcccgcgccttcagcgac
                                                     *     *       **     

A0A3Q1FLK7_BCL2-01      atgtccaggcagctctatctcaccaccaccacggcgcagaggag------
A0A3Q1GM98_BCL2L10      tcctgaggcagtgcgggccggacttctgctccag----------------
A0A3Q1EQB9_MCL1-01      tcatacaatggtatgatcaaca-aactgtcgctggatgacataggggatg
A0A3Q1EQB9_MCL1-02      tcatacaatggtatgatcaaca-aactgtcgctggatgacataggggatg
A0A3Q1EVP6_BCL2L1-      ctgtcttcgcagattgacatcacccctgaaacggcctaccacag------
A0A3Q1FR00_BCL2L1-      ctgcacagccagctgcacatcacgcccgccaccgcctaccagag------
A0A3Q1FR00_BCL2L1-      ctgcacagccagctgcacatcacgcccgccaccgcctaccagag------
                                             *   *     * *                

A0A3Q1FLK7_BCL2-01      -------attcgccgaggtgatagacgaac---tgttccgggacggg---
A0A3Q1GM98_BCL2L10      -------cctcaggatggtgatggaggagc---tggtggaagatggacac
A0A3Q1EQB9_MCL1-01      atgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggaca
A0A3Q1EQB9_MCL1-02      atgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggaca
A0A3Q1EVP6_BCL2L1-      -------ctttaagagtgtgatggatgagg---tgttcaaggatggg---
A0A3Q1FR00_BCL2L1-      -------cttcgagaacgtcatggacgagg---tgttccgggacggc---
A0A3Q1FR00_BCL2L1-      -------cttcgagaacgtcatggacgagg---tgttccgggacggc---
                                 *       *   * *   *     ** *    **  *    

A0A3Q1FLK7_BCL2-01      gtgaactggggccggattatcgctttcttcgagttcggggggacggtgtg
A0A3Q1GM98_BCL2L10      ttgaactgggggagggttgtttcccttttcacctttactggggtgctggc
A0A3Q1EQB9_MCL1-01      accaactggggtcgtattacgagcctggtggccttcggggcggtggtttg
A0A3Q1EQB9_MCL1-02      accaactggggtcgtattacgagcctggtggccttcggggcggtggtttg
A0A3Q1EVP6_BCL2L1-      gtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtg
A0A3Q1FR00_BCL2L1-      gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgctgtg
A0A3Q1FR00_BCL2L1-      gtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgctgtg
                           ********  *  *        *  *    **    *      *   

A0A3Q1FLK7_BCL2-01      cgtcgagtgcgcggccaaagaggagatgacatcgcaggtggacaaca---
A0A3Q1GM98_BCL2L10      cagacagctgctggagcagaaggacacaaagccggggctggaccccggga
A0A3Q1EQB9_MCL1-01      tcagtacttaaagga---gaggggcagggagaactgcgtggacctgg---
A0A3Q1EQB9_MCL1-02      tcagtacttaaagga---gaggggcagggagaactgcgtggacctgg---
A0A3Q1EVP6_BCL2L1-      tgtggaatgcgtaga---gaagaatatgagtgagctggttccccgca---
A0A3Q1FR00_BCL2L1-      cgtcgagtgcgtgga---aaaggagatgagccccctggtgggcagga---
A0A3Q1FR00_BCL2L1-      cgtcgagtgcgtgga---aaaggagatgagccccctggtgggcagga---
                             *       *       *   *            *   *       

A0A3Q1FLK7_BCL2-01      ------------------------------------------tcgcggag
A0A3Q1GM98_BCL2L10      agcgacaggaactgggacagaggcctgtaaactgcagaggactggcagag
A0A3Q1EQB9_MCL1-01      ------------------------------------------tcagccag
A0A3Q1EQB9_MCL1-02      ------------------------------------------tcagccag
A0A3Q1EVP6_BCL2L1-      ------------------------------------------tcgctgac
A0A3Q1FR00_BCL2L1-      ------------------------------------------tcgtagag
A0A3Q1FR00_BCL2L1-      ------------------------------------------tcgtagag
                                                                  *     * 

A0A3Q1FLK7_BCL2-01      tggatgacggagtattta------aatggacctcttaacagctggataca
A0A3Q1GM98_BCL2L10      accatagctgattacttg------ggagaggagaagaaagactggct---
A0A3Q1EQB9_MCL1-01      gagatttccacatacctgctttctgaacagc------gagactggct---
A0A3Q1EQB9_MCL1-02      gagatttccacatacctgctttctgaacagc------gagactggct---
A0A3Q1EVP6_BCL2L1-      tggatgaccatgtacctg------gatgagcacatcagtccctggatcca
A0A3Q1FR00_BCL2L1-      tggatgaccgtctacctg------gacaaccacattcaggactggatcca
A0A3Q1FR00_BCL2L1-      tggatgaccgtctacctg------gacaaccacattcaggactggatcca
                           **  *    **  *                        **** *   

A0A3Q1FLK7_BCL2-01      agataacggggg----atgggatgccttcgtggag--ctgtatgacag--
A0A3Q1GM98_BCL2L10      -gttggagaatgatggatgggaaggcttctgtaag--ttctccctcagtg
A0A3Q1EQB9_MCL1-01      -ggtcaaaaacaactcatgggacggttttgtggagttttttcgagtagca
A0A3Q1EQB9_MCL1-02      -ggtcaaaaacaactcatgggacggttttgtggagttttttcgagtagca
A0A3Q1EVP6_BCL2L1-      gagccaaggaga----ctgggagtgctttgctgag-atttttgggcagaa
A0A3Q1FR00_BCL2L1-      gggccagggagg----atgggagcgttttgctgag-atcttcggtcagga
A0A3Q1FR00_BCL2L1-      gggccagggagg----atgggagcgttttgctgag-atcttcggtcagga
                                         *****    **     **     *     **  

A0A3Q1FLK7_BCL2-01      --------acagagggactcagtc---ttcagttgctcctggccctccat
A0A3Q1GM98_BCL2L10      c--------cagaaaggcga-------gtcag--------gacttgtcca
A0A3Q1EQB9_MCL1-01      gaccctgagttgacggtcagaaacacactcat--------ggc-ctttgc
A0A3Q1EQB9_MCL1-02      gaccctgagttgacggtcagaaacacactcat--------ggc-ctttgc
A0A3Q1EVP6_BCL2L1-      cgccgct-gcagaagcacggaggt---ctcgg--------gatactctga
A0A3Q1FR00_BCL2L1-      cgcggcg-gccgagagcaggaggt---ctcag--------gagagcttca
A0A3Q1FR00_BCL2L1-      cgcggcg-gccgagagcaggaggt---ctcag--------gagagcttca
                                   **               **          *         

A0A3Q1FLK7_BCL2-01      caagacggttttcggt---------ctggcagcact--cggg--------
A0A3Q1GM98_BCL2L10      tgaagacagcgctgtttg-------ctgctgccggtgtcggc--------
A0A3Q1EQB9_MCL1-01      tggatttgctggtattggggcaacactggccctgctgatcag--------
A0A3Q1EQB9_MCL1-02      tggatttgctggtattggggcaacactggccctgctgatcagactggaaa
A0A3Q1EVP6_BCL2L1-      agcgatggctgctagccgga-----ggggtgctgctaatggg--------
A0A3Q1FR00_BCL2L1-      agaagtggctgctggtgggg-----atgacggtggtgacggg--------
A0A3Q1FR00_BCL2L1-      agaagtggctgctggtgggg-----atgacggtggtgacggg--------
                                                   *       *              

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      gtaaatttggggaaacccagaggaccgggagaggagccggaggcaaacga
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      tggatccaggggggccggaggaaaccacaggagaggaaccggaggagaca
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------

A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A3Q1GM98_BCL2L10      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      cgatgcctgcagggaccgaggcagggggcaagggaaccgacagaactgga
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------

A0A3Q1FLK7_BCL2-01      ------------------------------------gcggcgagcctcac
A0A3Q1GM98_BCL2L10      ------------------------------------ctcgctggactcac
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      gggttccaaggagggggaaccaggagggacacggagccggcaggggtcca
A0A3Q1EVP6_BCL2L1-      --------------------------------agtgctggctggtgtact
A0A3Q1FR00_BCL2L1-      --------------------------------ggtggtggtggggtcgct
A0A3Q1FR00_BCL2L1-      --------------------------------ggtggtggtggggtcgct

A0A3Q1FLK7_BCL2-01      catcg---------------------------------------------
A0A3Q1GM98_BCL2L10      cttcc---------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      agacggaagcaaggagacagactgggcaggagtggtccggacagcgggat
A0A3Q1EVP6_BCL2L1-      cattg---------------------------------------------
A0A3Q1FR00_BCL2L1-      catcg---------------------------------------------
A0A3Q1FR00_BCL2L1-      catcg---------------------------------------------

A0A3Q1FLK7_BCL2-01      ------------------------------gagcgtaccttacacaaaa-
A0A3Q1GM98_BCL2L10      ------------------------------------tcctggtgcg----
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      cctccaggagaggagaacagagaaaaagacgttagtctcagaaatacttg
A0A3Q1EVP6_BCL2L1-      ------------------------------------ctaagaaaca----
A0A3Q1FR00_BCL2L1-      ------------------------------------cccagaaacgcct-
A0A3Q1FR00_BCL2L1-      ------------------------------------cccagaaacgcct-

A0A3Q1FLK7_BCL2-01      ----gtga
A0A3Q1GM98_BCL2L10      ----ctaa
A0A3Q1EQB9_MCL1-01      ----gtga
A0A3Q1EQB9_MCL1-02      tcacgtaa
A0A3Q1EVP6_BCL2L1-      ----gtga
A0A3Q1FR00_BCL2L1-      ----gtga
A0A3Q1FR00_BCL2L1-      ----gtga
                             * *

© 1998-2022Legal notice