Dataset for CDS BAX of Organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2YAM0_BAX-05      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2I2YAM0_BAX-02      atggacgggtccggggagca------------------------------
A0A2I2YAM0_BAX-03      atggacgggtccggggagcagcccagaggcggggtgacacctcgttctga
A0A2I2YAM0_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2I2YAM0_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       ********************                              

A0A2I2YAM0_BAX-05      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2I2YAM0_BAX-02      ------------------------------------tttcatccaggatc
A0A2I2YAM0_BAX-03      -----------------------ttctgcaccctcactccatccccactc
A0A2I2YAM0_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2I2YAM0_BAX-04      gcagatcatgaagacaggggcccttttgcttcagg---------------
                                                                         

A0A2I2YAM0_BAX-05      gagcagggcgaatggggggggaggcacccgagctggccctggacccggtg
A0A2I2YAM0_BAX-02      gagcagggcgaatggggggggaggcacccgagctggccctggacccggtg
A0A2I2YAM0_BAX-03      ta----ggcgaatggggggggaggcacccgagctggccctggacccggtg
A0A2I2YAM0_BAX-01      gagcagggcgaatggggggggaggcacccgagctggccctggacccggtg
A0A2I2YAM0_BAX-04      --------------------------------------------------
                                                                         

A0A2I2YAM0_BAX-05      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2I2YAM0_BAX-02      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2I2YAM0_BAX-03      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2I2YAM0_BAX-01      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2I2YAM0_BAX-04      --------------------------------------------------
                                                                         

A0A2I2YAM0_BAX-05      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2I2YAM0_BAX-02      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2I2YAM0_BAX-03      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2I2YAM0_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2I2YAM0_BAX-04      --------------------------------ggatgattgccgccgtgg
                                                       ******************

A0A2I2YAM0_BAX-05      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I2YAM0_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I2YAM0_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I2YAM0_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I2YAM0_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                       **************************************************

A0A2I2YAM0_BAX-05      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2I2YAM0_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2I2YAM0_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2I2YAM0_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2I2YAM0_BAX-04      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
                       **************************************************

A0A2I2YAM0_BAX-05      cagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
A0A2I2YAM0_BAX-02      cagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
A0A2I2YAM0_BAX-03      cagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
A0A2I2YAM0_BAX-01      cagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
A0A2I2YAM0_BAX-04      cagcaaactggtactcaaggccctgtgcaccaaggtgccggaactgatca
                       **************************************************

A0A2I2YAM0_BAX-05      gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggc
A0A2I2YAM0_BAX-02      gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggc
A0A2I2YAM0_BAX-03      gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggc
A0A2I2YAM0_BAX-01      gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggc
A0A2I2YAM0_BAX-04      gaaccatcatgggctggacgttggacttcctccgggagcggctgttgggc
                       **************************************************

A0A2I2YAM0_BAX-05      tggatccaagaccagggtggttgggtg-----------------------
A0A2I2YAM0_BAX-02      tggatccaagaccagggtggttgggggctgcccctggccgagtcactgaa
A0A2I2YAM0_BAX-03      tggatccaagaccagggtggttg---------------------------
A0A2I2YAM0_BAX-01      tggatccaagaccagggtggttg---------------------------
A0A2I2YAM0_BAX-04      tggatccaagaccagggtggttg---------------------------
                       ***********************                           

A0A2I2YAM0_BAX-05      ----------------------agactcctcaagcctcctcacccccacc
A0A2I2YAM0_BAX-02      gcgactgatgtccctgtctccaggac------ggcctcctctcctacttt
A0A2I2YAM0_BAX-03      ----------------------ggac------ggcctcctctcctacttt
A0A2I2YAM0_BAX-01      ----------------------ggac------ggcctcctctcctacttt
A0A2I2YAM0_BAX-04      ----------------------ggac------ggcctcctctcctacttt
                                              ***       ******** **  *   

A0A2I2YAM0_BAX-05      accacgccctcaccactgcccctgccccaccgtcccttccccccgccact
A0A2I2YAM0_BAX-02      gggacgcccacgtggcagaccgtg--------------------accatc
A0A2I2YAM0_BAX-03      gggacgcccacgtggcagaccgtg--------------------accatc
A0A2I2YAM0_BAX-01      gggacgcccacgtggcagaccgtg--------------------accatc
A0A2I2YAM0_BAX-04      gggacgcccacgtggcagaccgtg--------------------accatc
                          ****** *    * * ** **                     ***  

A0A2I2YAM0_BAX-05      cctctgggaccctgggccttctggagcaggtcacagtggtgccctctccc
A0A2I2YAM0_BAX-02      tttgtgg-------------cgggagt-gctcaccgc----ctcactcac
A0A2I2YAM0_BAX-03      tttgtgg-------------cgggagt-gctcaccgc----ctcactcac
A0A2I2YAM0_BAX-01      tttgtgg-------------cgggagt-gctcaccgc----ctcactcac
A0A2I2YAM0_BAX-04      tttgtgg-------------cgggagt-gctcaccgc----ctcactcac
                         * ***             * ****  * **** *     * * *** *

A0A2I2YAM0_BAX-05      catcttcagatcatcagatgtggtctataatgcgtttttacgtgtctga-
A0A2I2YAM0_BAX-02      catctgga----agaagatg-----------------------ggctgag
A0A2I2YAM0_BAX-03      catctgga----agaagatg-----------------------ggctga-
A0A2I2YAM0_BAX-01      catctgga----agaagatg-----------------------ggctga-
A0A2I2YAM0_BAX-04      catctgga----agaagatg-----------------------ggctga-
                       *****  *    *  *****                       * **** 

A0A2I2YAM0_BAX-05      -------------------------------------
A0A2I2YAM0_BAX-02      gcccccagctgccttggactgtgtttttcctccataa
A0A2I2YAM0_BAX-03      -------------------------------------
A0A2I2YAM0_BAX-01      -------------------------------------
A0A2I2YAM0_BAX-04      -------------------------------------
                                                            

© 1998-2023Legal notice