Dataset for CDS BCL-2-like of organism Cavia porcellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A286XQQ9_BCL2L2-      atggcgacc--------------------ccagcctcggcccc-ag----
A0A286Y1M5_MCL1-01      atgtcgcctgaggaggagctggacgggtacgagccggagcccctcg----
H0W1T3_BCL2-01          atggc------------------------tcac-----gctgggagaaca
A0A286XUI2_BCL2A1-      atggg------------------------tcacatcctgctcagcg----
A0A286Y5D6_BCL2L1-      atg-----------------------------------tctcaaag----
                        ***                                    *     *    

A0A286XQQ9_BCL2L2-      -------acacacgggctctggtggctgactttgt---------------
A0A286Y1M5_MCL1-01      -------ggaagcggccggccgt-gctgcccttgct--------------
H0W1T3_BCL2-01          gggtatgataaccgggaaatagtgatgaagtacatccactataagctgtc
A0A286XUI2_BCL2A1-      --------ccact----gctggcagt---ctcgatctgc-gcgagc----
A0A286Y5D6_BCL2L1-      --------caactgggagctggtggttgactttctctcctacaagctttc

A0A286XQQ9_BCL2L2-      -------------------aggctataagctgaggc--agaagggtt---
A0A286Y1M5_MCL1-01      ------------------ggggctggtgggggaggccgggaagagcccca
H0W1T3_BCL2-01          ccagagaggctac-----gagtgggatgccggagacgggagcgcact---
A0A286XUI2_BCL2A1-      ------------cagcagcaggctgctgtctgccgcccaggatgatt---
A0A286Y5D6_BCL2L1-      ccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca---
                                            *          *                  

A0A286XQQ9_BCL2L2-      --------------atgtctgtgga---gctggccctgg----ggagggc
A0A286Y1M5_MCL1-01      gcgccgacggttcgctgccctcgac---gccgcccccggcggaggaggag
H0W1T3_BCL2-01          --------gggtcgcaactccccgcttggtgtgccccgggacccggccgc
A0A286XUI2_BCL2A1-      --------gacctggagttcaggtacacgcaggctctgg----------c
A0A286Y5D6_BCL2L1-      --------ggactgaaggcccagaagggactgaatcagagatggagaccc
                                                           * *            

A0A286XQQ9_BCL2L2-      ccagcagctgacccgctgcaccaagccatgcggg----cagctggggatg
A0A286Y1M5_MCL1-01      gaggaggaggacgcgctgtaccgacagtcgctggagatcatctcgcggta
H0W1T3_BCL2-01          cagg-----acctcgccaccgccacccctg--------------------
A0A286XUI2_BCL2A1-      ccag-----gactacctgctccacgtcctgcaggtgcctcagtgcgag--
A0A286Y5D6_BCL2L1-      ccag-----tgccatcaatggcaacccatcctggcacctaactgatagtc
                           *       *   *     *                            

A0A286XQQ9_BCL2L2-      agttcgaga--------cccgattccggcgcacc-----------ttctc
A0A286Y1M5_MCL1-01      cctgcggga--------gcaggccgcgg-gcgccaaggactcgaagccgc
H0W1T3_BCL2-01          -----------------gccggcctcgc-----c---gtcgcccaggggc
A0A286XUI2_BCL2A1-      -----------------accagccccag-----caaggcatccaaggtgc
A0A286Y5D6_BCL2L1-      ccacggtgaatggggccactggccacag-----ca--gtagtttggatgc
                                          *      *       *               *

A0A286XQQ9_BCL2L2-      tgatctggct---gctcagctgcatgtgacccctgg---------ctcag
A0A286Y1M5_MCL1-01      tgggcggggtggggcccaccagcaggaaggcactggag------accctg
H0W1T3_BCL2-01          c------tgc---gctcagcccggtgccacctgtggtccacctgaccctc
A0A286XUI2_BCL2A1-      tgcaggacat---ggccctttccgtccaggaagaggtg------------
A0A286Y5D6_BCL2L1-      c-cgggaggt---gatcc---ccat---ggcagcagtgaagcaagctctt
                                     *  *                  *              

A0A286XQQ9_BCL2L2-      c----------------ccagcaacgcttcacccaggtc----tccgacg
A0A286Y1M5_MCL1-01      cggcgggtcggggacggcgtgcagcgcaaccaccagaccgccttccaagg
H0W1T3_BCL2-01          cgccaggccggcgatgacttctcccgccgctatcgccaagacttcgctga
A0A286XUI2_BCL2A1-      -gagaggcggctga--------aaccgtgg--ctggacagaatt----ga
A0A286Y5D6_BCL2L1-      agggaggcgggcgatgagtttgaacttcggtaccggcgagcattcagcga
                                                *                  *      

A0A286XQQ9_BCL2L2-      aacttttccaa---------------------------------------
A0A286Y1M5_MCL1-01      aatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatccttgt
H0W1T3_BCL2-01          gatgtccagccagctgcacctgacgcctttcaccgcgaggggacgctttg
A0A286XUI2_BCL2A1-      cgtggagtc---------catcgac------actgcgaagtcgatattca
A0A286Y5D6_BCL2L1-      cttaacatctcagctccacatcaccccggggacagcatatcagagctttg

A0A286XQQ9_BCL2L2-      -------ggtggcccc----------------------aactggggccgt
A0A286Y1M5_MCL1-01      cgcgagtggttgcccttgttttcagtgacggcgtaacaaactggggcagg
H0W1T3_BCL2-01          cc------------acgctcttcagggatggggtg---aactgggggagg
A0A286XUI2_BCL2A1-      accaagtgatggagaaggagttcgaggatggcatcattaactggggacgg
A0A286Y5D6_BCL2L1-      aacaggtagtgaatgaactcttccgggatggggta---aactggggtcgc
                                                              ********  * 

A0A286XQQ9_BCL2L2-      cttgtggccttctttgtctttggcgctgccctgtgtg----------ctg
A0A286Y1M5_MCL1-01      attgtgactctcatttcttttggtg----cctttgtggccaaacacttga
H0W1T3_BCL2-01          attgtggccttctttgagttcggtggggtcatgtgtg----------tgg
A0A286XUI2_BCL2A1-      attgtgactatctttgcttttggggggg--tcatcct----------caa
A0A286Y5D6_BCL2L1-      attgtggcctttttctccttcggcggggcattgtgcg----------tgg
                         ***** *  *  *    ** ** *        *                

A0A286XQQ9_BCL2L2-      agagtgtcaacaaag------------aga--tgc----aaccactggtg
A0A286Y1M5_MCL1-01      agagcataaaccaag------------aaagctgcatcgaaccattagcg
H0W1T3_BCL2-01          agagtgtcaaccggg------------aga--tgt----cacctctggtg
A0A286XUI2_BCL2A1-      gaaactcccacgagagccaatcgccccaga--tgt----ggacacttaca
A0A286Y5D6_BCL2L1-      agagcgtagacaagg------------aga--tgc----aggtattggtg
                          *      **                * *  **           *    

A0A286XQQ9_BCL2L2-      ggccaagtgcaggagtggatggtggcctacctggagacgcgcctggccga
A0A286Y1M5_MCL1-01      ga--aagtatcacagatgct-ctggtgcactcaaaaa-gggactggctag
H0W1T3_BCL2-01          gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacac
A0A286XUI2_BCL2A1-      agg-agatttcctacttcgtggctgagttcataatgagccgcatgggagg
A0A286Y5D6_BCL2L1-      aggcggatcgcaagctggatggctacttacctgaatgaccacctagaacc
                               *           *         *             *      

A0A286XQQ9_BCL2L2-      ctggatccacagcagtgggggctgg--------------gcggagttcac
A0A286Y1M5_MCL1-01      tcaaa--caaagaggctgggatggg-----------tttgtggagttc--
H0W1T3_BCL2-01          ctggatccaggataacggaggatggg----------taggtgcatgtttg
A0A286XUI2_BCL2A1-      ctggatacggcagaacggaggctgggacaacggcttcgtgcggaagtttg
A0A286Y5D6_BCL2L1-      ttggatccaggacaacggcggctgggaca-----cttttgtggaactcta
                            *  *         * *   **              * * *  *   

A0A286XQQ9_BCL2L2-      --agctctatacggggacggggccctggaggaggcgcggcgtctgcggga
A0A286Y1M5_MCL1-01      ----ttccatata-----gaggatctagaag----gcggcatc-------
H0W1T3_BCL2-01          --------------------------------------------------
A0A286XUI2_BCL2A1-      ---------------agcccaaatctggctg-------------------
A0A286Y5D6_BCL2L1-      cgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaacc

A0A286XQQ9_BCL2L2-      ggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgg
A0A286Y1M5_MCL1-01      -------------------agaaatgtgctgct---ggcttttgca--gg
H0W1T3_BCL2-01          --------------------------------------------------
A0A286XUI2_BCL2A1-      gc-----------------tgacttttg-tgggagtta-------tggga
A0A286Y5D6_BCL2L1-      gc-----------------tggttgctgacgggcgtgactgtggctggcg

A0A286XQQ9_BCL2L2-      gggccctggtaactgtaggggccttttttg-----ctagcaagtga-
A0A286Y1M5_MCL1-01      tgttgctgg----agtaggggctggtttggcatatctaataagatag
H0W1T3_BCL2-01          -------------------------------------agtgag----
A0A286XUI2_BCL2A1-      cagctctgtgagatgctctctctcctgaagcaattctactga-----
A0A286Y5D6_BCL2L1-      tggttctgctgg--gctcgctcttcagtcgga-----aatga-----
                                                             *   *     

© 1998-2022Legal notice