Dataset for CDS MCL-1 of organism Salvator merianae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D0E7Q9_MCL1-01      atgccattgttgaatcggaaagcgatggtgctgtgctgtgggagcgcctc
A0A8D0E7Q9_MCL1-02      atgccattgttgaatcggaaagcgatggtgctgtgctgtgggagcgcctc
                        **************************************************

A0A8D0E7Q9_MCL1-01      gggcctggccccggcggcccctgtctcccccggcgcgggcggcggcggcg
A0A8D0E7Q9_MCL1-02      gggcctggccccggcggcccctgtctcccccggcgcgggcggcggcggcg
                        **************************************************

A0A8D0E7Q9_MCL1-01      gcggcggctgcggcggcccgttaacggccctggcgtcgccgttctcggcg
A0A8D0E7Q9_MCL1-02      gcggcggctgcggcggcccgttaacggccctggcgtcgccgttctcggcg
                        **************************************************

A0A8D0E7Q9_MCL1-01      ccgcgcatcggcggcttcccctggccgcgcccgggcctggcggagggggc
A0A8D0E7Q9_MCL1-02      ccgcgcatcggcggcttcccctggccgcgcccgggcctggcggagggggc
                        **************************************************

A0A8D0E7Q9_MCL1-01      gccgctggggctgtacaggcccctggagggggcgccccggccccgagcgg
A0A8D0E7Q9_MCL1-02      gccgctggggctgtacaggcccctggagggggcgccccggccccgagcgg
                        **************************************************

A0A8D0E7Q9_MCL1-01      cgccgcccgcccgggaaggaggaggaggaggaggaggagaagaagagctg
A0A8D0E7Q9_MCL1-02      cgccgcccgcccgggaaggaggaggaggaggaggaggagaagaagagctg
                        **************************************************

A0A8D0E7Q9_MCL1-01      gacggcttcgagccggaggacgaggcgcccgcgggcggcgggccggcctc
A0A8D0E7Q9_MCL1-02      gacggcttcgagccggaggacgaggcgcccgcgggcggcgggccggcctc
                        **************************************************

A0A8D0E7Q9_MCL1-01      tcccgcgtcgccggcctcggagggcgaagactccgactcggccgcctcct
A0A8D0E7Q9_MCL1-02      tcccgcgtcgccggcctcggagggcgaagactccgactcggccgcctcct
                        **************************************************

A0A8D0E7Q9_MCL1-01      cctcctcgtcctcgtcctccgccgccgccgccgaccgccacgacgacctg
A0A8D0E7Q9_MCL1-02      cctcctcgtcctcgtcctccgccgccgccgccgaccgccacgacgacctg
                        **************************************************

A0A8D0E7Q9_MCL1-01      cgccgggtgacgctggagctggtgcggcgctacctgcacgaggccgccga
A0A8D0E7Q9_MCL1-02      cgccgggtgacgctggagctggtgcggcgctacctgcacgaggccgccga
                        **************************************************

A0A8D0E7Q9_MCL1-01      gcggagcgacgccaagccggcggcggcggcggcaacggcgggcggcggca
A0A8D0E7Q9_MCL1-02      gcggagcgacgccaagccggcggcggcggcggcaacggcgggcggcggca
                        **************************************************

A0A8D0E7Q9_MCL1-01      agaagctctttcagggcctcatgggccggttcgggaccccctcggcgggc
A0A8D0E7Q9_MCL1-02      agaagctctttcagggcctcatgggccggttcgggaccccctcggcgggc
                        **************************************************

A0A8D0E7Q9_MCL1-01      gccccttccgccttggcttcctcctcgtcgtcgccctgcgtggcccaggc
A0A8D0E7Q9_MCL1-02      gccccttccgccttggcttcctcctcgtcgtcgccctgcgtggcccaggc
                        **************************************************

A0A8D0E7Q9_MCL1-01      gctggagaccctccgcagggtgggcgacgccattctcgacaagcaccagc
A0A8D0E7Q9_MCL1-02      gctggagaccctccgcagggtgggcgacgccattctcgacaagcaccagc
                        **************************************************

A0A8D0E7Q9_MCL1-01      tggccttccaaggaatgcttaagaagctggaaatcaagaatgaagaagac
A0A8D0E7Q9_MCL1-02      tggccttccaaggaatgcttaagaagctggaaatcaagaatgaagaagac
                        **************************************************

A0A8D0E7Q9_MCL1-01      ctcaagactgtatcagaagttgcaactcatgttttcagtgacggagtgac
A0A8D0E7Q9_MCL1-02      ctcaagactgtatcagaagttgcaactcatgttttcagtgacggagtgac
                        **************************************************

A0A8D0E7Q9_MCL1-01      aaactggggccggattgtgactctcatctcttttggtgcgttcgttgcaa
A0A8D0E7Q9_MCL1-02      aaactggggccggattgtgactctcatctcttttggtgcgttcgttgcaa
                        **************************************************

A0A8D0E7Q9_MCL1-01      aacacctgaagaccataaacaaagagaacggcatcagtacgttggcagac
A0A8D0E7Q9_MCL1-02      aacacctgaagaccataaacaaagagaacggcatcagtacgttggcagac
                        **************************************************

A0A8D0E7Q9_MCL1-01      atcatcacagacgtgctggtgacagataagcgagaatggctgctgaacca
A0A8D0E7Q9_MCL1-02      atcatcacagacgtgctggtgacagataagcgagaatggctgctgaacca
                        **************************************************

A0A8D0E7Q9_MCL1-01      caatgcctgggaagggttcattaaattcttccacgtagaagacatagagg
A0A8D0E7Q9_MCL1-02      caatgcctgggaagggttcattaaattcttccacgtagaagacatagagg
                        **************************************************

A0A8D0E7Q9_MCL1-01      gcagcatccgaaatgttctggtagcttttgcgggcgtggcaggtgtagga
A0A8D0E7Q9_MCL1-02      gcagcatccgaaatgttctggtagcttttgcgggcgtggcaggtgtagga
                        **************************************************

A0A8D0E7Q9_MCL1-01      gcaggtttggcgtacctgatccggccaccagaattgtctctgagtcagat
A0A8D0E7Q9_MCL1-02      gcaggtttggcgtacctgatccg---------------------------
                        ***********************                           

A0A8D0E7Q9_MCL1-01      gtaa
A0A8D0E7Q9_MCL1-02      gtga
                        ** *

© 1998-2023Legal notice