Dataset for CDS BCL-2-like of organism Vulpes vulpes

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q7QZT9_MCL1-01      atgtt----------cggcctcaagagaaacg-----cagtaatcggact
A0A3Q7R8S3_BCL2L1-      atgtc---------------tcagagcaaccgggagctggtggttgactt
A0A3Q7T511_BCL2L2-      atggc-----------------------------------tggaagcctt
A0A3Q7T511_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A3Q7T511_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
                        ***                                     *    *   *

A0A3Q7QZT9_MCL1-01      caacctctactgtgggggggccgggctgggggaccgcagcggcggcgcct
A0A3Q7R8S3_BCL2L1-      tctctcctac------aagctttcccagaaaggata--------------
A0A3Q7T511_BCL2L2-      -----gccgt------ccgttgcggggcaaggttca--------------
A0A3Q7T511_BCL2L2-      tgtaggctat------aagctgaggcagaagggttatgtttgtggagctg
A0A3Q7T511_BCL2L2-      tgtaggctat------aagctgaggcagaagggttatgtttgtggagctg
                              *           *            *                  

A0A3Q7QZT9_MCL1-01      cctcttcgggagggcggcttttggcttcggggaaggaggccacgac--ca
A0A3Q7R8S3_BCL2L1-      ------------------------------------------------ca
A0A3Q7T511_BCL2L2-      --cctg--------------------tcac--------------------
A0A3Q7T511_BCL2L2-      gccctggagagggcccagcagctgatccactgcaccaagccatgcgggca
A0A3Q7T511_BCL2L2-      gccctggagagggcccagcagctgatccactgcaccaagccatgcgggca
                                                                          

A0A3Q7QZT9_MCL1-01      gacgggagggagggggag--------gggaagccggtgcggtgat-tggc
A0A3Q7R8S3_BCL2L1-      gctggagtcag--tttag-----------------------tgatgtgga
A0A3Q7T511_BCL2L2-      ----gaaacggatgttag-----------------ctcttcgaatctcac
A0A3Q7T511_BCL2L2-      gctggagatgagtttgagacccgcttccggcgcaccttctctgatttggc
A0A3Q7T511_BCL2L2-      gctggagatgagtttgagacccgcttccggcgcaccttctctgatttggc
                            *           **                         ** *   

A0A3Q7QZT9_MCL1-01      ggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggag
A0A3Q7R8S3_BCL2L1-      -agagaacagaactgaggccccaga----------------------agg
A0A3Q7T511_BCL2L2-      gagccaatcggcatccga-----------------------------gag
A0A3Q7T511_BCL2L2-      -agcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccag
A0A3Q7T511_BCL2L2-      -agcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccag
                                        *                                *

A0A3Q7QZT9_MCL1-01      ggtcgcgcggccctcacccattggcgctgagggccccaacgtcagcgcga
A0A3Q7R8S3_BCL2L1-      gact------gaatcagaga-------tggagaccccc-----agtgcca
A0A3Q7T511_BCL2L2-      ggct-------attgctgcg-------aggcgatcgga-----agattgg
A0A3Q7T511_BCL2L2-      gtctctgacgaactcttcca-------agggggcccca-----actgggg
A0A3Q7T511_BCL2L2-      gtctctgacgaactcttcca-------agggggcccca-----actgggg
                        *            *              *  *  *        *      

A0A3Q7QZT9_MCL1-01      cccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgc-----
A0A3Q7R8S3_BCL2L1-      tcaatggcaacccatcctggcacttggcagacagccctgcggtga-----
A0A3Q7T511_BCL2L2-      cctttt-------ctcctcgccct--------------------------
A0A3Q7T511_BCL2L2-      ccgtcttgtggccttctttgtctttggagctgcactgtgtgctgagagtg
A0A3Q7T511_BCL2L2-      ccgtcttgtggccttctttgtctttggagctgcactgtgtgctgagagtg
                         *                 *                              

A0A3Q7QZT9_MCL1-01      cgcctgaagagatggaaggcccggcagccgacgccatcatgtcgcccgaa
A0A3Q7R8S3_BCL2L1-      -----------atgga------------------------gccactggc-
A0A3Q7T511_BCL2L2-      ---------------a------------------------gccagcggc-
A0A3Q7T511_BCL2L2-      tcaacaaagagatgga------------------------gccacttgtg
A0A3Q7T511_BCL2L2-      tcaacaaagagatgga------------------------gccacttgtg
                                       *                        * *    *  

A0A3Q7QZT9_MCL1-01      gaggagctagacgggtacgagccggaacctttggggaagcggccggcggt
A0A3Q7R8S3_BCL2L1-      -------cacagcagcag-----------cttggatgcccg---------
A0A3Q7T511_BCL2L2-      ---------caatcaccgagcgtcatatactcgcggatccgcctgg----
A0A3Q7T511_BCL2L2-      ggacaagtgcaagagtggatggtggcctacctggagacacggctggccg-
A0A3Q7T511_BCL2L2-      ggacaagtgcaagagtggatggtggcctacctggagacacggctggccg-
                                  *                     *      **         

A0A3Q7QZT9_MCL1-01      cctgcctttgctggagttggtgggggaggccagcagtggccccggcatgg
A0A3Q7R8S3_BCL2L1-      -------------------------------ggaggtgatcc--------
A0A3Q7T511_BCL2L2-      ------------------------aggagctggaagcgatcaaagctcg-
A0A3Q7T511_BCL2L2-      actggatccacagcagtgggggctgggagctggaagcgatcaaagctcg-
A0A3Q7T511_BCL2L2-      actggatccacagcagtgggggctgggagctggaagcgatcaaagctcg-
                                                        *  * *  *         

A0A3Q7QZT9_MCL1-01      acggctcgctaccctcgacgccacccccggcggaggaggaggaagatgag
A0A3Q7R8S3_BCL2L1-      ------------------------ccatggcagcggtgaaacaagc----
A0A3Q7T511_BCL2L2-      ----------------------agtcagggagatggaggaagaagctgag
A0A3Q7T511_BCL2L2-      ----------------------agtcagggagatggaggaagaagctgag
A0A3Q7T511_BCL2L2-      ----------------------agtcagggagatggaggaagaagctgag
                                                 *  **    ** * *  ***     

A0A3Q7QZT9_MCL1-01      ttgtaccggcagtccctggagattatctctcggtaccttcgggaacaggc
A0A3Q7R8S3_BCL2L1-      --gctgagggaggctgggga------------------------------
A0A3Q7T511_BCL2L2-      aagttaaaggagctacagaa------------------------------
A0A3Q7T511_BCL2L2-      aagttaaaggagctacagaa------------------------------
A0A3Q7T511_BCL2L2-      aagttaaaggagctacagaa------------------------------
                          *     * **     * *                              

A0A3Q7QZT9_MCL1-01      cacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagcc
A0A3Q7R8S3_BCL2L1-      ---------tgagtttg---aactgagg------------------tacc
A0A3Q7T511_BCL2L2-      ---------cgaggtagagaaacagatgaatatg--------agtccacc
A0A3Q7T511_BCL2L2-      ---------cgaggtagagaaacagatgaatatg--------agtccacc
A0A3Q7T511_BCL2L2-      ---------cgaggtagagaaacagatgaatatg--------agtccacc
                                   **   *   ***    *                    **

A0A3Q7QZT9_MCL1-01      ggaaggcgtt--------agagacc----ctccggcgagtcggggacggg
A0A3Q7R8S3_BCL2L1-      ggcgggcatt-------cagtgacctgacatcc-----------------
A0A3Q7T511_BCL2L2-      tccaggcaatgctggcccagtgatc--atgtccattgaagagaagatgga
A0A3Q7T511_BCL2L2-      tccaggcaatgctggcccagtgatc--atgtccattgaagagaagatgga
A0A3Q7T511_BCL2L2-      tccaggcaatgctggcccagtgatc--atgtccattgaagagaagatgga
                            ***  *        ** ** *     ***                 

A0A3Q7QZT9_MCL1-01      gtgcagcgcaaccacgagacagccttccaaggcatgct-tcggaaactgg
A0A3Q7R8S3_BCL2L1-      --cagcttc---------acatcaccccagggacagcatatcagagcttt
A0A3Q7T511_BCL2L2-      ggctgatgc---------ccgttccatttatgttggca-atgtggactat
A0A3Q7T511_BCL2L2-      ggctgatgc---------ccgttccatttatgttggca-atgtggactat
A0A3Q7T511_BCL2L2-      ggctgatgc---------ccgttccatttatgttggca-atgtggactat
                                *          *           *   **         **  

A0A3Q7QZT9_MCL1-01      acatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgattgtccat
A0A3Q7R8S3_BCL2L1-      g-------agcag----gtagtgaa----------------------cga
A0A3Q7T511_BCL2L2-      ggtgcaacagcagaagagttggaag----------------------cac
A0A3Q7T511_BCL2L2-      ggtgcaacagcagaagagttggaag----------------------cac
A0A3Q7T511_BCL2L2-      ggtgcaacagcagaagagttggaag----------------------cac
                                * *      *  *  *                       *  

A0A3Q7QZT9_MCL1-01      gttttcagtgacggagt--aacaaactggggcaggat----tgtgac---
A0A3Q7R8S3_BCL2L1-      actctt----ccgggatggggtgaactggggtcgcat----tgtggc---
A0A3Q7T511_BCL2L2-      actttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaa
A0A3Q7T511_BCL2L2-      actttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaa
A0A3Q7T511_BCL2L2-      actttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaa
                          * *       *   *      *** * *     **    **** *   

A0A3Q7QZT9_MCL1-01      tcttatttcctttggtgcctttgtggccaaacacttgaagag--tataaa
A0A3Q7R8S3_BCL2L1-      ctttttctcctt------cggtggggcactgtgcgtggagag--cgtaga
A0A3Q7T511_BCL2L2-      tttagtggccat------cctaaaggttttgcatatatagagttctcaga
A0A3Q7T511_BCL2L2-      tttagtggccat------cctaaaggttttgcatatatagagttctcaga
A0A3Q7T511_BCL2L2-      tttagtggccat------cctaaaggttttgcatatatagagttctcaga
                          *  *  ** *      *     **         *  ****     * *

A0A3Q7QZT9_MCL1-01      ccaagaa-----------------------agctgcatcgaaccattagc
A0A3Q7R8S3_BCL2L1-      caaggag---atgcaggtattggtg-----agtcggatcgcagc-ttgga
A0A3Q7T511_BCL2L2-      caaagagtcagtgaggacttccttggccttagatgagtcactat-ttaga
A0A3Q7T511_BCL2L2-      caaagagtcagtgaggacttccttggccttagatgagtcactat-ttaga
A0A3Q7T511_BCL2L2-      caaagagtcagtgaggacttccttggccttagatgagtcactat-ttaga
                        * * **                        **  *  **      ** * 

A0A3Q7QZT9_MCL1-01      agaaagcatcac-agatgttctcgtaaggacgaaacgagactggctagtc
A0A3Q7R8S3_BCL2L1-      tggccacttacctgaatgacc---------acctagagccttggat--cc
A0A3Q7T511_BCL2L2-      ggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggca--tc
A0A3Q7T511_BCL2L2-      ggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggca--tc
A0A3Q7T511_BCL2L2-      ggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggca--tc
                         *    *    *    **  *             *       **     *

A0A3Q7QZT9_MCL1-01      aaacaaaga--ggctgggatgggtttgtggagttcttccatgtagaggac
A0A3Q7R8S3_BCL2L1-      aggagaacggcggctgggatacttttgtggaactctac-------gggaa
A0A3Q7T511_BCL2L2-      agcacaaca--gaccggggt-----------ttcccac-------gagcc
A0A3Q7T511_BCL2L2-      agcacaaca--gaccggggt-----------ttcccac-------gagcc
A0A3Q7T511_BCL2L2-      agcacaaca--gaccggggt-----------ttcccac-------gagcc
                        *    **    * * *** *              *  *         *  

A0A3Q7QZT9_MCL1-01      ctagaaggtggc----------atcagaaatgtgct--------------
A0A3Q7R8S3_BCL2L1-      caatgcagcagccgag-----agccggaaagg---------------cca
A0A3Q7T511_BCL2L2-      cgataccgtgcccggactaccaactacaacagctcccgctctcgattcta
A0A3Q7T511_BCL2L2-      cgataccgtgcccggactaccaactacaacagctcccgctctcgattcta
A0A3Q7T511_BCL2L2-      cgataccgtgcccggactaccaactacaacagctcccgctctcgattcta
                        * *    *   *               **  *                  

A0A3Q7QZT9_MCL1-01      -gctggcttttgcaggtgttgctggagt---------aggagctggtt--
A0A3Q7R8S3_BCL2L1-      ggagcgcttcaaccgctggttcctgacaggcat-gactgtggctggcgtg
A0A3Q7T511_BCL2L2-      cagtggttttaacagcaggccccggggtcgcgtctacaggggccgggcta
A0A3Q7T511_BCL2L2-      cagtggttttaacagcaggccccggggtcgcgtctacaggggccgggcta
A0A3Q7T511_BCL2L2-      cagtggttttaacagcaggccccggggtcgcgtctacaggggccgggcta
                             * **   * *  *   *  *             *  ** **    

A0A3Q7QZT9_MCL1-01      -----------tggcatatctaat------aagatag
A0A3Q7R8S3_BCL2L1-      gttctgc----tgggctcgctcttcagtcggaaatga
A0A3Q7T511_BCL2L2-      gagcgacatcatggtattcccctt--------actaa
A0A3Q7T511_BCL2L2-      gagcgacatcatggtattcccctt--------actaa
A0A3Q7T511_BCL2L2-      gagcgacatcatggtattcccctt--------actaa
                                   ***  *  *   *          *  

© 1998-2020Legal notice