Dataset for CDS BCL2L1 of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1JJ42_BCL2L1-      gttatgtcgtactataaccgagaattagtggtgtactttattaagtacaa
A0A8B9LKW7_BCL2L1-      ---atgtcgtactataaccgagaattagtggtgtactttattaagtacaa
                           ***********************************************

A0A3B1JJ42_BCL2L1-      actctcacagaggaactatcctactaatcacatcggactcatggaagaaa
A0A8B9LKW7_BCL2L1-      actctcacagaggaactatcctactaatcacatcggactcgtggaagaaa
                        **************************************** *********

A0A3B1JJ42_BCL2L1-      caaatcgaactgaagggggccaggaagcggaggggaatgcagaggcggcc
A0A8B9LKW7_BCL2L1-      caaatcgaactgaagggggccaggaagcggaggggaacgcagaggcggcc
                        ************************************* ************

A0A3B1JJ42_BCL2L1-      ggggtgactcccaccgcagtcgttaacgggtccgtaaatgggacgagtca
A0A8B9LKW7_BCL2L1-      gcggtgactcccaccgcagtcgttaacgggtccgtaaatgggacgagtca
                        * ************************************************

A0A3B1JJ42_BCL2L1-      cggtgcggcagggtcgcccacctcgtccccccagagaagggccaacgggg
A0A8B9LKW7_BCL2L1-      cggtgcggcagggtcgcccacctcgtccccccagagaagggccaacgggg
                        **************************************************

A0A3B1JJ42_BCL2L1-      ctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgag
A0A8B9LKW7_BCL2L1-      ctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgag
                        **************************************************

A0A3B1JJ42_BCL2L1-      tttgagctgcgatactctcgcgccttcagcgacctgtcctcccagctgca
A0A8B9LKW7_BCL2L1-      tttgagctgcgatactctcgcgccttcagcgacctgtcctcccagctgca
                        **************************************************

A0A3B1JJ42_BCL2L1-      catcacgcctgctactgcgtaccagagctttgagagcgtgatggacgagg
A0A8B9LKW7_BCL2L1-      catcacgcctgctactgcgtaccagagctttgagagcgtgatggacgagg
                        **************************************************

A0A3B1JJ42_BCL2L1-      tgtttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttc
A0A8B9LKW7_BCL2L1-      tgtttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttc
                        **************************************************

A0A3B1JJ42_BCL2L1-      ggcggggctctgtgtgtggagtgcgtggagaaggagatgagccccctggt
A0A8B9LKW7_BCL2L1-      ggcggggctctgtgtgtggagtgcgtggagaaggagatgagccccctggt
                        **************************************************

A0A3B1JJ42_BCL2L1-      gggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagc
A0A8B9LKW7_BCL2L1-      gggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagc
                        **************************************************

A0A3B1JJ42_BCL2L1-      cctggatccaggagcaaggaggatgggaacgctttgcagagatctttggg
A0A8B9LKW7_BCL2L1-      cctggatccaggagcaaggaggatgggaacgctttgcagagatctttggg
                        **************************************************

A0A3B1JJ42_BCL2L1-      aacgacacagcagcagagagcagaaggatgcaggaacgctataagatgtg
A0A8B9LKW7_BCL2L1-      aacgacacagcagcagagagcagaaggatgcaggaacgctataagatgtg
                        **************************************************

A0A3B1JJ42_BCL2L1-      gctgctggtggggatgaccctgttcacaggaattgtggtgggctctctca
A0A8B9LKW7_BCL2L1-      gctgctggtggggatgaccctgttcacaggaattgtggtgggctctctca
                        **************************************************

A0A3B1JJ42_BCL2L1-      tcgctcagaagcgtctgtaa
A0A8B9LKW7_BCL2L1-      tcgctcagaagcgtctgtaa
                        ********************

© 1998-2022Legal notice