Dataset for CDS BCL-2-like of organism Otus sunia

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8AIP7_BCL2A1-      atg-----------------------------------------------
A0A8C8A4L8_BCL2L1-      atgtc------------------cagcagtaaccgggag-ttagtgattg
A0A8C8ANG9_BCL2-01      atggctcatccggggagaagaggctacgataaccgggag-atagtgctga
A0A8C8B1M7_MCL1-01      atggtgca-------------ggctgcgagcacggcgtgcccggtgccgg
                        ***                                               

A0A8C8AIP7_BCL2A1-      -------------------------------gaaactgctgagtt-----
A0A8C8A4L8_BCL2L1-      actttgtttcctacaagctctcgcagaagg-gatacagctggagt-----
A0A8C8ANG9_BCL2-01      agtacatccactataaactctcgcagaggg-gatacgactgggctgccgg
A0A8C8B1M7_MCL1-01      gggacagcggc--------acggcggggggtggtggtgctggggtgtgtg
                                                       *      ***   *     

A0A8C8AIP7_BCL2A1-      -------------------------------------------------c
A0A8C8A4L8_BCL2L1-      cagctggaggaggag-----------------------------------
A0A8C8ANG9_BCL2-01      cga--ggacagggcacccctgcctccgggtctctctcctcctgctgctgc
A0A8C8B1M7_MCL1-01      tagctgcacgggggggccctgc--------------------------gc
                                                                          

A0A8C8AIP7_BCL2A1-      tattacgtttattact----------------------------------
A0A8C8A4L8_BCL2L1-      -gatgagaacaggactgacttt--------gcagtggagg----------
A0A8C8ANG9_BCL2-01      tgctgcggtcgctgctgc-tgctgct----gctgctgggacttcctctga
A0A8C8B1M7_MCL1-01      tgctgaggg-gctgctgcacggggctaagaacggccggggc-----ccgg
                           *  *       **                                  

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --acgcc-------------------------------------------
A0A8C8ANG9_BCL2-01      tcacact-------------------------------------------
A0A8C8B1M7_MCL1-01      cagcaccgaggggcggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C8AIP7_BCL2A1-      ---------------------------tagctcaagattatctgcaatat
A0A8C8A4L8_BCL2L1-      ---------------------------gagatggacggtgtcctcaa---
A0A8C8ANG9_BCL2-01      ---------------------------gggctgg-tgtc-tccgcac---
A0A8C8B1M7_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnngagctggatggc-ttcg-ag---
                                                     * *        *    *    

A0A8C8AIP7_BCL2A1-      gtgcttcaggagtcacatcttggaccagc--------------------c
A0A8C8A4L8_BCL2L1-      ------cgggagcccctcctggcacccgc----------ccgccagccac
A0A8C8ANG9_BCL2-01      ------cccgagccc---cccggctcggc--------tgctgctagccac
A0A8C8B1M7_MCL1-01      ------cccgaggccgagcgcggcccggcgggggactcgctgcccggcac
                              *  *** *    *  *   * **                    *

A0A8C8AIP7_BCL2A1-      caaaccagggttgctcatgtcttgcgaaacattgcatc------------
A0A8C8A4L8_BCL2L1-      gtagtgaacggagccg---ccg----------tgcaccggagcagcctcg
A0A8C8ANG9_BCL2-01      ----------gcgccc---ccggccgaggggctgcgcc---ccgcacccc
A0A8C8B1M7_MCL1-01      cccgcccgggccgcccgcgccgcccgatgggctgcggcaggactcgctgg
                                    **      *           ***  *            

A0A8C8AIP7_BCL2A1-      -------------------------------------ttcgctgcaagat
A0A8C8A4L8_BCL2L1-      aagtccatgaaatcgttcaagcggccgatgtgaggcaggcgctgagagag
A0A8C8ANG9_BCL2-01      aggtc------------------------gtccacctcgccctgcgccag
A0A8C8B1M7_MCL1-01      agctc------------------------atcagccgctacctgcgggag
                                                                 ***    * 

A0A8C8AIP7_BCL2A1-      caaaccgaggag--------------------------------gctctc
A0A8C8A4L8_BCL2L1-      gcgggggatgag----------------------tttgagttgaggtacc
A0A8C8ANG9_BCL2-01      gcgggcgacgag----------------------ttctcccgccgctacc
A0A8C8B1M7_MCL1-01      gcggcgggcgaggccgagcccggcgccaagaagctcttcccggggctgct
                              *  ***                                * *   

A0A8C8AIP7_BCL2A1-      agaccattcttg-------gacaggattgat-------------------
A0A8C8A4L8_BCL2L1-      ggcgggctttcagcgacctcacttcccagct-------------------
A0A8C8ANG9_BCL2-01      agagggactttgcccaaatgtccggccagct-------------------
A0A8C8B1M7_MCL1-01      gggcgg-----gcccggccggccgggcgggtcgggcgacgccgtgatgga
                         *                   *      * *                   

A0A8C8AIP7_BCL2A1-      attacctctgtagctgttgc------------------------------
A0A8C8A4L8_BCL2L1-      ----ccacatcacccccggc------------acggcgta----------
A0A8C8ANG9_BCL2-01      ----gcacctgacgcccttc------------acgg--------------
A0A8C8B1M7_MCL1-01      gaaggcgctggaaacgctgcggagggtcggcgacggcgtcatgcagaagc
                             * *   *       *                              

A0A8C8AIP7_BCL2A1-      -------------caagagaattttcaa----------------------
A0A8C8A4L8_BCL2L1-      -------------ccaga----gctttg----------------------
A0A8C8ANG9_BCL2-01      -------------cccggggccgcttcg-----tgg--------------
A0A8C8B1M7_MCL1-01      acgagctcgccttccagggaatgcttcggaagctggaaatccagaaagag
                                     *  *       *                         

A0A8C8AIP7_BCL2A1-      -------------tggtgtcatgcaagaaa--------aatttgctgatg
A0A8C8A4L8_BCL2L1-      ----------agcaggta--gtgaacgaac--------tcttccgcgatg
A0A8C8ANG9_BCL2-01      -------------cggtg--gtggaggagc--------tcttccgagacg
A0A8C8B1M7_MCL1-01      gaagatctgcaatcagtat-gtgaagtggctgcccacgtgttcagtgatg
                                       **    ** *               **    ** *

A0A8C8AIP7_BCL2A1-      gaaatactaactggggacgaattatgaccatatttacatttggaggtctt
A0A8C8A4L8_BCL2L1-      gagt---gaactggggtcgcatcgtggctttcttctccttcggagga---
A0A8C8ANG9_BCL2-01      gggt---taactggggcaggatcgtggccttcttcgagtttggcggc---
A0A8C8B1M7_MCL1-01      gagtaacaaactggggtagagtggtgacgctcatctcgtttggtgccttt
                        *       ********  *  *  ** *  *  *    ** ** *     

A0A8C8AIP7_BCL2A1-      ctcactaagaagcttcaagagcat------ggagt------tcagctcac
A0A8C8A4L8_BCL2L1-      ---gccttg-tgcgtggagagcgttgacaaggagatgcgggt------at
A0A8C8ANG9_BCL2-01      ---gtgatg-tgcgtggagagtgtcaaccgggaga--tgtctccccttgt
A0A8C8B1M7_MCL1-01      gttgcgaaa-cacctgaagagcataaaccaggagaagtgcatcagctcgc
                                    * *  ****  *      ****       *        

A0A8C8AIP7_BCL2A1-      tggagaggagaaggagcagatttcttatttcatcacagagtacataataa
A0A8C8A4L8_BCL2L1-      tggtgggacgcattgt-----atcttggatgacc---atgtacttgaccg
A0A8C8ANG9_BCL2-01      agacag----catcgc-----cgcctggatgacc---gagtacctgaacc
A0A8C8B1M7_MCL1-01      tggcagggatcatcacggacgcgctcgtctcatc---gaa----------
                         *         *           *     * * *                

A0A8C8AIP7_BCL2A1-      acaacaaagctgaatggatagatgcaaacggtggctgggaaaatggcttc
A0A8C8A4L8_BCL2L1-      accacctagatccctggatccaggagaatggcggatggg---agcggttt
A0A8C8ANG9_BCL2-01      ggcacctgcacaactggatccaggacaacggaggctggg---atgccttc
A0A8C8B1M7_MCL1-01      -------gcgcgagtggctactgagccaaggaggctggg---agggcttt
                                      *** *        * ** ** ****   *    ** 

A0A8C8AIP7_BCL2A1-      ctaatgaagtttgaa-------------------------------agaa
A0A8C8A4L8_BCL2L1-      gtggacctctacgggaacaatgctgctgccgaggtgaggaagggccagga
A0A8C8ANG9_BCL2-01      gtcgagttgtatggcaacagt-------------------------atga
A0A8C8B1M7_MCL1-01      gtcgacttctttcg----agt-------------------------cgag
                         *       *                                        

A0A8C8AIP7_BCL2A1-      gatcactactatctttctccaaaattacagccatattcatagctgttttc
A0A8C8A4L8_BCL2L1-      gaccttcaacaaatggctcctga----ccggggcgacggtggcaggagtg
A0A8C8ANG9_BCL2-01      ggcctttctttgatttctcctggatctctctgaagactatcctgagtctg
A0A8C8B1M7_MCL1-01      gacctgga--aggcagcatcagaaatgtactgatggcgtttgcaggtgtg
                        *  *            *  *                   *        * 

A0A8C8AIP7_BCL2A1-      tccttattcagaga---------------------------gtacta---
A0A8C8A4L8_BCL2L1-      cttctgctgggatc----------cctg--------ctgagccgcaa---
A0A8C8ANG9_BCL2-01      gttctggtgggagcttgcatcactcttggcgcttatctcggacataa---
A0A8C8B1M7_MCL1-01      gccggactgggagcgag-------cttggcct---------acatgatcc
                               *  **                                  *   

A0A8C8AIP7_BCL2A1-      -ctga
A0A8C8A4L8_BCL2L1-      -gtga
A0A8C8ANG9_BCL2-01      -gtag
A0A8C8B1M7_MCL1-01      ggtga
                          *  

© 1998-2022Legal notice