Dataset for CDS BCL2A1 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3HBP6_BCL2A1-      atgacagactgcgaatttggatatatttacaggctagctcaggactatct
A0A2I3HBP6_BCL2A1-      atgacagactgcgaatttggatatatttacaggctagctcaggactatct
                        **************************************************

A0A2I3HBP6_BCL2A1-      gcagtacgtcctacagataccacagcctggatcaggtccaagcaaaacgt
A0A2I3HBP6_BCL2A1-      gcagtacgtcctacagataccacagcctggatcaggtccaagcaaaacgt
                        **************************************************

A0A2I3HBP6_BCL2A1-      ccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaag
A0A2I3HBP6_BCL2A1-      ccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaag
                        **************************************************

A0A2I3HBP6_BCL2A1-      aatctgaagccgtgcttggacaatgttaatgttgtgtccatagacactgc
A0A2I3HBP6_BCL2A1-      aatctgaagccgtgcttggacaatgttaatgttgtgtccatagacactgc
                        **************************************************

A0A2I3HBP6_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
A0A2I3HBP6_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
                        **************************************************

A0A2I3HBP6_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtc
A0A2I3HBP6_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtc
                        **************************************************

A0A2I3HBP6_BCL2A1-      aagaaacttctacgacagcgaactgccccggatgtggatacttacaagga
A0A2I3HBP6_BCL2A1-      aagaaacttctacgacagcgaactgccccggatgtggatacttacaagga
                        **************************************************

A0A2I3HBP6_BCL2A1-      gatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
A0A2I3HBP6_BCL2A1-      gatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
                        **************************************************

A0A2I3HBP6_BCL2A1-      taaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
A0A2I3HBP6_BCL2A1-      taaggcaaaacggaggctgggggaaatggcat------------------
                        ****************** *** ******* *                  

A0A2I3HBP6_BCL2A1-      taaatctggctggatgacttttctagaagttacaggaaagatctcaatac
A0A2I3HBP6_BCL2A1-      --aatc--------------------------------acatgcctatgc
                          ****                                * **  * ** *

A0A2I3HBP6_BCL2A1-      tgttgactagaaaggacactccatattgtgaaaccggcctaatttttctg
A0A2I3HBP6_BCL2A1-      tg------------------------------------------------
                        **                                                

A0A2I3HBP6_BCL2A1-      actcttatggaaacaattgccaacacatacttctactttaaaataaacaa
A0A2I3HBP6_BCL2A1-      ------gtagagtcagtggcccacaagaa----------gaggaaaatgg
                               * **  ** * *** ***   *           *   ***   

A0A2I3HBP6_BCL2A1-      ctttgatgatgtaacttga
A0A2I3HBP6_BCL2A1-      ctttg-----------taa
                        *****           * *

© 1998-2020Legal notice