Dataset for CDS BAX-like of Organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2HLV2_BAX-01       atgga----------------cgggtcc----ggggagcaacccagaggc
A0A3Q2HLV2_BAX-02       atgga----------------cgggtcc----ggggagcaacccagaggc
F7CDD0_BOK-01           atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgc
A0A3Q2HT35_BAK1-01      atggcgtccgggcaagg--cccaggtcctccggggaaggagtgcgga-ga
A0A3Q2HT35_BAK1-02      atggcgtccgggcaagg--cccaggtcctccggggaaggagtgcgga-ga
                        ****                   ****      *     *     ** * 

A0A3Q2HLV2_BAX-01       ggggggccca----ccagctctgagcagatcatg----aagaca------
A0A3Q2HLV2_BAX-02       ggggggccca----ccagctctgagcagatcatg----aagaca------
F7CDD0_BOK-01           ctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcgc
A0A3Q2HT35_BAK1-01      gcctgccccgtcctccacttctgaggagcaggtagcccgggaca------
A0A3Q2HT35_BAK1-02      gcctgccccgtcctccacttctgaggagcaggtagcccgggaca------
                            * **      ***      ** **    *       * **      

A0A3Q2HLV2_BAX-01       -----ggggcccttttgcttcagggtttcatccaggatcgcgcggggcgg
A0A3Q2HLV2_BAX-02       -----ggggcccttttgcttcagg--------------------------
F7CDD0_BOK-01           tcggcagggagttcgtgcacgcgcggctgctgcgcgctggcctcgcctgg
A0A3Q2HT35_BAK1-01      -cggaggaggttttccgcagctacgtttatt----accgccaccagcagg
A0A3Q2HT35_BAK1-02      -cggaggaggttttccgcagctacgtttatt----accgccaccagcagg
                              * *   *   **                                

A0A3Q2HLV2_BAX-01       atggggggagacacacccgagctgggcctggaggaggtgccccaggatgc
A0A3Q2HLV2_BAX-02       --------------------------------------------------
F7CDD0_BOK-01           agc--gcg------------cccgagcgtgccgcccctgcccccggcggc
A0A3Q2HT35_BAK1-01      agcaggag------------gccgagggggcgg---ctgcgcccgccgac
A0A3Q2HT35_BAK1-02      agcaggag------------gccgagggggcgg---ctgcgcccgccgac
                                                                          

A0A3Q2HLV2_BAX-01       gtccaccaagaagctgagcgagtgtctca----------agcgcatcgga
A0A3Q2HLV2_BAX-02       --------------------------------------------------
F7CDD0_BOK-01           cgcctggcagaggtgtgcgcggtgctgct-----------gcgcctggga
A0A3Q2HT35_BAK1-01      c------cagagatggacaccctgcccctggaacctaacagcaccatggg
A0A3Q2HT35_BAK1-02      c------cagagatggacaccctgcccctggaacctaacagcaccatggg
                                                                          

A0A3Q2HLV2_BAX-01       gatgagctggacag----taacatggagctgcagaggatgattgcggccg
A0A3Q2HLV2_BAX-02       -----------------------------------ggatgattgcggccg
F7CDD0_BOK-01           gatgagctggagctgatccggcccagtgtctaccgcaacgtggctcgcca
A0A3Q2HT35_BAK1-01      gc--aggtggggcgg---cagctcgccatcatcggggacgacatcaatcg
A0A3Q2HT35_BAK1-02      gc--aggtggggcgg---cagctcgccatcatcggggacgacatcaatcg
                                                             * *        * 

A0A3Q2HLV2_BAX-01       tggacac--------ggactccc--cccgcg-------------------
A0A3Q2HLV2_BAX-02       tggacac--------ggactccc--cccgcg-------------------
F7CDD0_BOK-01           gctgaacatctcactgcagtctgagaccgtggtga-----ctg-------
A0A3Q2HT35_BAK1-01      gcgctacgactc---ggagttccagaccatgctgaagcacctgcagccaa
A0A3Q2HT35_BAK1-02      gcgctacgactc---ggagttccagaccatgctgaagcacctgcagccaa
                             **        * * *      **  *                   

A0A3Q2HLV2_BAX-01       ---------aggtctttttccgagtggcagctgagatgttttcc------
A0A3Q2HLV2_BAX-02       ---------aggtctttttccgagtggcagctgagatgttttcc------
F7CDD0_BOK-01           ---------acgccttcctggctgtgtctgcccagatcttctct------
A0A3Q2HT35_BAK1-01      cagcagagaacgcctat---gagctgttcaccaagatcgcctcg------
A0A3Q2HT35_BAK1-02      cagcagagaacgcctat---gagctgttcaccaagatcgcctcgaggcca
                                 * * **         **    *  ****    **       

A0A3Q2HLV2_BAX-01       -----------------------gacggc-aacttcaactggggccgggt
A0A3Q2HLV2_BAX-02       -----------------------gacggc-aacttcaactggggccgggt
F7CDD0_BOK-01           ---------------------------gcaggcatcacgtggggcaaggt
A0A3Q2HT35_BAK1-01      --------------agcctgtttgagagc-ggcatcaactggggccgagt
A0A3Q2HT35_BAK1-02      gcagcaacacccacagcctgtttgagagc-ggcatcaactggggccgagt
                                                   **   * ***  ******   **

A0A3Q2HLV2_BAX-01       tgttgcccttttctactttgccagcaaattggtgctcaaggcc-----ct
A0A3Q2HLV2_BAX-02       tgttgcccttttctactttgccagcaaattggtgctcaaggcc-----ct
F7CDD0_BOK-01           ggtg----tccctgtacttggtggctg--cggggct---ggccgtggact
A0A3Q2HT35_BAK1-01      ggtggctctcctggggttcggctaccg--c----ct---ggcc-----ct
A0A3Q2HT35_BAK1-02      ggtggctctcctggggttcggctaccg--c----ct---ggcc-----ct
                         **     *        * *    *         **   ****     **

A0A3Q2HLV2_BAX-01       gtgcaccaaggtgcccgagctgatcaggaccat-----catgggctggac
A0A3Q2HLV2_BAX-02       gtgcaccaaggtgcccgagctgatcaggaccat-----catgggctggac
F7CDD0_BOK-01           gcgtg-cggcaggcccagcccgccatggtccatgctctcgttgactgcct
A0A3Q2HT35_BAK1-01      gcatgtctaccagcgcggcctgaccggcttcctgagccagttgacccgct
A0A3Q2HT35_BAK1-02      gcatgtctaccagcgcggcctga---------------------------
                        *     *     ** *   * *                            

A0A3Q2HLV2_BAX-01       actggacttccttcgagagcggctgctgggctggatccaggaccagggtg
A0A3Q2HLV2_BAX-02       actggacttccttcgagagcggctgctgggctggatccaggaccagggtg
F7CDD0_BOK-01           cggggagtttgtgcgcaagaccctggcgacctggctgcggaggcgtggcg
A0A3Q2HT35_BAK1-01      tcgtggctgaattcatgctgcatcactgcattgcccggtggatcgcacag
A0A3Q2HT35_BAK1-02      --------------------------------------------------
                                                                          

A0A3Q2HLV2_BAX-01       gttgggacggcctcctc---------------tccgactttgggtcaccc
A0A3Q2HLV2_BAX-02       gttgggacggcctcctc---------------tccgactttgggtcaccc
F7CDD0_BOK-01           gatggactgacgtcctcaagtgtgtggtcagcacggaccccggctaccgc
A0A3Q2HT35_BAK1-01      agggg-----------cggctgggtggcggctctggacttgggaaatggc
A0A3Q2HT35_BAK1-02      --------------------------------------------------
                                                                          

A0A3Q2HLV2_BAX-01       acgtggcagacagtgaccatcttcgtggccggagtgctcaccgcctcgct
A0A3Q2HLV2_BAX-02       acgtggcagacagtgaccatcttcgtggccggagtgctcaccgcctcgct
F7CDD0_BOK-01           tcccattggctcgtggctgcgttctgcagtgtcggccgcttcctgaaggc
A0A3Q2HT35_BAK1-01      cccatccggaatgtgctgatagttctggctgtggttctgttgggccagta
A0A3Q2HT35_BAK1-02      --------------------------------------------------
                                                                          

A0A3Q2HLV2_BAX-01       caccatctggaagaagat------gggctga
A0A3Q2HLV2_BAX-02       caccatctggaagaagat------gggctga
F7CDD0_BOK-01           tgccttcttcatgctgttgccagagagatga
A0A3Q2HT35_BAK1-01      tgtggtacgaagattctt---caagtcatga
A0A3Q2HT35_BAK1-02      -------------------------------
                                                       

© 1998-2023Legal notice