Dataset for CDS BCL-2 of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1S3LY44_BCL2-01      ---atggcaaacg---------acgacaaccgctgtatagtggaaaagta
A0A1S3R1W1_BCL2-01      ---atggcaaacg---------acgacaaccgcttcatagtggaaaagta
A0A1S3NIV8_BCL2-01      atgatggcaaacgagaatccttacaacagtcgctttattgtcgaaaaata
A0A1S3Q9V5_BCL2-01      atgatggcgaacgataatccttataacagtcgctttattgttgaaaaata
                           ***** ****         *  ***  ****  ** ** ***** **

A0A1S3LY44_BCL2-01      catttgtcacaaactcttgaaaaggggatatgcgtgggatttcgagaatg
A0A1S3R1W1_BCL2-01      catttgtcacaaactcttgaaacgaggatatgcgtgggatttcgaggatg
A0A1S3NIV8_BCL2-01      catccatcacaaactgttgaacatgggatttgtatggaaattt---caag
A0A1S3Q9V5_BCL2-01      catccatcacaaactgttgaagaagggatttgtatgggaattt---aatc
                        ***   ********* *****    **** **  *** * **     *  

A0A1S3LY44_BCL2-01      ccgaggatgaggaagatgctgataataatgggtcgatgatttctcctccg
A0A1S3R1W1_BCL2-01      ccgaggaggaggaaggtgccgctaataatgggtcgatgatttctcctcgg
A0A1S3NIV8_BCL2-01      cagaaaacga------ttctccaaataatggctttggggacccctctaca
A0A1S3Q9V5_BCL2-01      cagaaaatga------ttccccaaataatggctttggggagccctctccc
                        * **  * **      * *    ******** *    *    *  **   

A0A1S3LY44_BCL2-01      cct------------ggtttggcacggcggtgccacggggccaataacgc
A0A1S3R1W1_BCL2-01      ctg------------ggtttggcacggcggtgccacggggccaataacgc
A0A1S3NIV8_BCL2-01      cccaactcccccgaagtttttgcacggaggtccca---gcccaccgccgc
A0A1S3Q9V5_BCL2-01      cctaactcccctgaagtttttgcacggaggtccca---gccctccgctga
                        *              * *** ****** *** ***   * **      * 

A0A1S3LY44_BCL2-01      cagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacc
A0A1S3R1W1_BCL2-01      cggcccgagcagcgtccctagtctttccaaatggctctcccaaccggacc
A0A1S3NIV8_BCL2-01      gggcgaggacaccgaccctccttaccaaaacaggagtccgcaacctgacc
A0A1S3Q9V5_BCL2-01      aggcgtggacactgactctccgctcccaaacaggatcccgcaaccggacc
                          *   *  **  * * *          **  **    * *** * ****

A0A1S3LY44_BCL2-01      cgcatgcagctattcacagagttttgcgtgaggccggggacgaactcgaa
A0A1S3R1W1_BCL2-01      cgcatgcagctattcacagagttttgcgtgaggccggggatgaactcgaa
A0A1S3NIV8_BCL2-01      cacatgccaggctccacagggtcctgcgcgatgcgggtggcgagattgaa
A0A1S3Q9V5_BCL2-01      gacatgcccggctccatagggtgctgcgcgaggcgggggacgagattgaa
                          *****     * ** ** **  **** ** ** ** *  **  * ***

A0A1S3LY44_BCL2-01      cgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
A0A1S3R1W1_BCL2-01      agactgtaccagcccgacttcgcagagatgtcacaccagctgtatctcac
A0A1S3NIV8_BCL2-01      agaatgtatcagcgggactttgcagagatgtcggggcagttgcattttac
A0A1S3Q9V5_BCL2-01      ataatgtatcagcgggactttgcagagatgtcggggcagttgcattttac
                          * **** ****  ***** ** ********    **  ** ** * **

A0A1S3LY44_BCL2-01      gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttca
A0A1S3R1W1_BCL2-01      atcctccacggctgagaggagatttagagaggtgatagacgagctgttca
A0A1S3NIV8_BCL2-01      acccagcacggcacagagaaggtttaccgctgtaatagatgagctcttca
A0A1S3Q9V5_BCL2-01      gcccagtacagcacagagaaggtttactgctgtaatagaggagctcttcc
                          *    *  **  * ** ** ** *  *  ** ***** ***** *** 

A0A1S3LY44_BCL2-01      gggacggggttaactggggacgaattgtcgccttcttcgagttcgggggc
A0A1S3R1W1_BCL2-01      gggatggggttaactggggacggattatcgccttcttcgagttcgggggc
A0A1S3NIV8_BCL2-01      gcgacggggtaaactggggtcggattgtggctttctttgagtttggaggg
A0A1S3Q9V5_BCL2-01      gcgacggtgtaaactggggtcggattgtggctttctttgagtttggaggg
                        * ** ** ** ******** ** *** * ** ***** ***** ** ** 

A0A1S3LY44_BCL2-01      acaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgacca
A0A1S3R1W1_BCL2-01      acaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatca
A0A1S3NIV8_BCL2-01      acaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtagacaa
A0A1S3Q9V5_BCL2-01      acaatgtgcgtggagagcgtcaaccgggagatgacgacccaggtagacaa
                        ***** ** *****  **** ***  *** ****** * ***** **  *

A0A1S3LY44_BCL2-01      catcgccgggtggatgacggagtatctaaatggaccgctgcacagctgga
A0A1S3R1W1_BCL2-01      catcgcggtgtggatgacagagtatctaaatggaccactgctcagctgga
A0A1S3NIV8_BCL2-01      catcgctcgttggatgatggagtacttgaacggacccctacagaactgga
A0A1S3Q9V5_BCL2-01      cattgcccattggatgacagagtacctgaacggacccctgcagaactgga
                        *** **    *******  *****  * ** ***** ** *  * *****

A0A1S3LY44_BCL2-01      ttcaagagaacgggggatgggaggcctttgttgagctctatgacagacag
A0A1S3R1W1_BCL2-01      ttcaggagaacgggggatgggaggcctttgttgagctctatgacagacag
A0A1S3NIV8_BCL2-01      tccaggagaatggtggctgggacgcctttgtggagatctatgagcagcag
A0A1S3Q9V5_BCL2-01      tccaggagaatggtgactgggacgcctttgtggagatctatgggcagcag
                        * ** ***** ** *  ***** ******** *** ******     ***

A0A1S3LY44_BCL2-01      agggactccgtgttctgttcgtggccgtccatcaagactgtctttggcct
A0A1S3R1W1_BCL2-01      agggactctgtgttctgttcgtggccatccatcaagaccgtcttcggcct
A0A1S3NIV8_BCL2-01      aggatctct------cactcctggccgtacctaaagacagtgttcggcct
A0A1S3Q9V5_BCL2-01      aggatctctgtcttccactcctggccctacctaaagacagtgttcggcct
                        ***  ***          ** ***** * * * ***** ** ** *****

A0A1S3LY44_BCL2-01      ggctgcactgggggctgcaagccttaccatcggagcttaccttacacaga
A0A1S3R1W1_BCL2-01      ggctgcactgggggccgcaagccttaccattggagcataccttacacaga
A0A1S3NIV8_BCL2-01      ggccgccctgggagccgctggagtcaccatcggagccttgttcacccaga
A0A1S3Q9V5_BCL2-01      ggccgccctgggtgcagccggagtcaccattggagcgttgttcatccaga
                        *** ** ***** ** **  *  * ***** ***** *   * *  ****

A0A1S3LY44_BCL2-01      agtga
A0A1S3R1W1_BCL2-01      agtga
A0A1S3NIV8_BCL2-01      agtga
A0A1S3Q9V5_BCL2-01      agtga
                        *****

© 1998-2020Legal notice