Dataset for CDS BCL2L1 of organism Seriola dumerili

[Download (right click)] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A3B4V3T1_BCL2L1-01      atgtctcaa---aacagagaactggtcgttttctacataaagcataagct
A0A3B4V9K8_BCL2L1-01      atgtcgtacagcaacagagagctggtggagttcttcataagctacaaact
                          *****  *    ******** ***** *  **** *****   * ** **

A0A3B4V3T1_BCL2L1-01      ctcccagagaaactatcctctcacccacatggaactcaatgagtctccca
A0A3B4V9K8_BCL2L1-01      gtctcaaagtaactgcccaacctcactgctgaggccagaggatgctggtg
                           ** ** ** ****  **   * * *   **   *   * **  **    

A0A3B4V3T1_BCL2L1-01      acaggactgatggcggggaggcagggttggttgaggaacagcggatagcg
A0A3B4V9K8_BCL2L1-01      gaaggactgagggagacaaggccaactcagctgccagt------------
                            ******** ** *   ****    *  * **                 

A0A3B4V3T1_BCL2L1-01      acgcacgccaatggaacttttaatggcacaagtcctgggacccgtgcaga
A0A3B4V9K8_BCL2L1-01      --------------aatggcttgttggtcaacagcagtgacaggtgtggt
                                        **    *  * *  ***   * * ***  ***  * 

A0A3B4V3T1_BCL2L1-01      gtccccgcagcggcagcaacggctgccgtcaacaacgagcctggacgcag
A0A3B4V9K8_BCL2L1-01      cagcccgggacgtcctcgc-------ccccgcatggtggcatagaggccg
                             ****   ** *  *         *  *        ** * ** ** *

A0A3B4V3T1_BCL2L1-01      tgaaagaggccctccgggattccgccaacgagtttgagttgcgatactcc
A0A3B4V9K8_BCL2L1-01      taaagtcagcccttaaggactctgctgacgaatttgaattgctcttcaac
                          * **    *****   *** ** **  **** ***** ****  * *  *

A0A3B4V3T1_BCL2L1-01      cgcgccttcagcgatctgcacaaccagctgcatatcacgccggccacagc
A0A3B4V9K8_BCL2L1-01      caagcgtttagtgacctttccacgcagcttgacatcactcctgacactgc
                          *  ** ** ** ** **   **  *****  * ***** ** * *** **

A0A3B4V3T1_BCL2L1-01      ttaccaaagctttgcgaacgtgatggatgaagtgttccgggacggcttca
A0A3B4V9K8_BCL2L1-01      ataccacagctttaagagtgtgatggatgagttgttcaaagatggagtca
                           ***** ******  **  ***********  *****   ** **  ***

A0A3B4V3T1_BCL2L1-01      actggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtc
A0A3B4V9K8_BCL2L1-01      actggggacgtatagtgggcctatttgcctttgggggtgtactgtgtgtg
                          ******* ** **  * ** ** ****  ** ** ** *  ******** 

A0A3B4V3T1_BCL2L1-01      gagtgtgtggagaaggagatgagtcctctggtgggcaggatcgtagagtg
A0A3B4V9K8_BCL2L1-01      gaatgcatacagaagaatatgagcgagctggtttcccgtatcacagactg
                          ** **  *  ***** * *****    *****   * * ***  *** **

A0A3B4V3T1_BCL2L1-01      gatgaccgtctacctggacaaccgcattcagccatggatccagagtcaag
A0A3B4V9K8_BCL2L1-01      gatgaccatgtacctggatgagcacatcagtccgtggatccagagccaag
                          ******* * ********  * * ***    ** *********** ****

A0A3B4V3T1_BCL2L1-01      gaggatgggagcgctttgctgaaatcttcgggcaggacgcagcagcagag
A0A3B4V9K8_BCL2L1-01      gaggctgggactgctttgctgagatgtttgggcaagacgccgctgcagaa
                          **** *****  ********** ** ** ***** ***** ** ***** 

A0A3B4V3T1_BCL2L1-01      agcaggaggtctcaggagagtttcaagaagtggctgctggcggggatgac
A0A3B4V9K8_BCL2L1-01      gcgaggagatctcgggaagctgtgatgaagtggctgctagttggagtggc
                             ***** **** ***   * * * ************ *  **  ** *

A0A3B4V3T1_BCL2L1-01      cctggtgaccggggttgtggtgggctcactgattgcccaaaagcgcctgt
A0A3B4V9K8_BCL2L1-01      aatgttggcaggagtgctgatgggcgtgctcatcgttaa---gaaacatt
                            ** ** * ** **  ** *****   ** ** *   *   *   *  *

A0A3B4V3T1_BCL2L1-01      ga
A0A3B4V9K8_BCL2L1-01      aa
                           *

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice