Dataset for CDS BCL2L1 of organism Seriola dumerili

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4V3T1_BCL2L1-      atgtctca---aaacagagaactggtcgttttctacataaagcataagct
A0A3B4V9K8_BCL2L1-      atgtcgtacagcaacagagagctggtggagttcttcataagctacaaact
                        *****  *    ******** ***** *  **** *****   * ** **

A0A3B4V3T1_BCL2L1-      ctcccagagaaactatcctctcacccacatggaactcaatgagtctccca
A0A3B4V9K8_BCL2L1-      gtctcaaagtaactgcccaacctcactgctgaggccagaggatgctggtg
                         ** ** ** ****  **   * * *   **   *   * **  **    

A0A3B4V3T1_BCL2L1-      acaggactgatggcggggaggcagggttggttgaggaacagcggatagcg
A0A3B4V9K8_BCL2L1-      gaaggactga-----gggagacaaggccaactcag---ctgccagtaatg
                          ********     ***** ** **     * **   * **   **  *

A0A3B4V3T1_BCL2L1-      ac--gcacgccaatggaacttttaatggcacaagt------cctgggacc
A0A3B4V9K8_BCL2L1-      gcttgttggtcaacag------cagtgacaggtgtggtcagcccgggac-
                         *  *   * ***  *       * ** **   **      ** ***** 

A0A3B4V3T1_BCL2L1-      cgtgcagagtccccgcagcggcagcaacggctgccgtcaacaacgagcct
A0A3B4V9K8_BCL2L1-      --------gtcctcgcccccgca--------tggtg----------gcat
                                **** ***  * ***        **  *          ** *

A0A3B4V3T1_BCL2L1-      ggacgcagtgaaagaggccctccgggattccgccaacgagtttgagttgc
A0A3B4V9K8_BCL2L1-      agaggccgtaaagtcagcccttaaggactctgctgacgaatttgaattgc
                         ** ** ** **    *****   *** ** **  **** ***** ****

A0A3B4V3T1_BCL2L1-      gatactcccgcgccttcagcgatctgcacaaccagctgcatatcacgccg
A0A3B4V9K8_BCL2L1-      tcttcaaccaagcgtttagtgacctttccacgcagcttgacatcactcct
                          * *  **  ** ** ** ** **   **  *****  * ***** ** 

A0A3B4V3T1_BCL2L1-      gccacagcttaccaaagctttgcgaacgtgatggatgaagtgttccggga
A0A3B4V9K8_BCL2L1-      gacactgcataccacagctttaagagtgtgatggatgagttgttcaaaga
                        * *** ** ***** ******  **  ***********  *****   **

A0A3B4V3T1_BCL2L1-      cggcttcaactggggccgcatcatagggctttttgtgttcggcggggcgc
A0A3B4V9K8_BCL2L1-      tggagtcaactggggacgtatagtgggcctatttgcctttgggggtgtac
                         **  ********** ** **  * ** ** ****  ** ** ** *  *

A0A3B4V3T1_BCL2L1-      tgtgtgtcgagtgtgtggagaaggagatgagtcctctggtgggcaggatc
A0A3B4V9K8_BCL2L1-      tgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatc
                        ******* ** **  *  ***** * *****    *****   * * ***

A0A3B4V3T1_BCL2L1-      gtagagtggatgaccgtctacctggacaaccgcattcagccatggatcca
A0A3B4V9K8_BCL2L1-      acagactggatgaccatgtacctggatgagcacatcagtccgtggatcca
                          *** ********* * ********  * * ***    ** ********

A0A3B4V3T1_BCL2L1-      gagtcaaggaggatgggagcgctttgctgaaatcttcgggcaggacgcag
A0A3B4V9K8_BCL2L1-      gagccaaggaggctgggactgctttgctgagatgtttgggcaagacgccg
                        *** ******** *****  ********** ** ** ***** ***** *

A0A3B4V3T1_BCL2L1-      cagcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcg
A0A3B4V9K8_BCL2L1-      ctgcagaagcgaggagatctcgggaagctgtgatgaagtggctgctagtt
                        * *****    ***** **** ***   * * * ************ *  

A0A3B4V3T1_BCL2L1-      gggatgaccctggtgaccggggttgtggtgggctcactgattgcccaaaa
A0A3B4V9K8_BCL2L1-      ggagtggcaatgttggcaggagtgctgatgggcgtgctcatcgttaagaa
                        **  ** *  ** ** * ** **  ** *****   ** ** *   * **

A0A3B4V3T1_BCL2L1-      gcgcctgtga
A0A3B4V9K8_BCL2L1-      acat---taa
                         *     * *

© 1998-2022Legal notice