Dataset for CDS Unclassified of organism Oncorhynchus mykiss

[Download (right click)]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C7TTA8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus mykiss (length=636 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgcagaggaggaggaaggtgctgctaataatgggtcgatgatttctcctcggccgggtttggcacggcggtgcc
acggggccaataacgccggaccgggcagcgtccctcgtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgacttcgcagagatgtcacaccagctgta
tcttacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggccctccacacccc
tcctgtcctgtgcttatttctgcctcttctcaggagagccattggaatgtctgcagctcaggaactgactacataa
>gnl|bcl2dbcds|A0A8C7UTW0_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss (length=396 residues).
atacatgtttgcgctatggatgttacaggtatgatcaacacactctatgtggatgacagaggggataacgtgaagttcct
tagtgcagtagcccatagcatctttgaagacgggaccgtcaactggggccgtgttgccagcctgacatcttttggggctg
cggtgtgccggtacttgagaggcaaggggagagacaactgtgtggatttggtgggagaggagatatcagagtacctggtc
actcaccacaaggactggctagtcaaacataactcctggactgggttcgtggagttctttccagtagcagaacctgagtc
cagatgtcggaacatcattatgaccatttttggattggctggtattggggcaacaatgaccttcttggttatgtga
>gnl|bcl2dbcds|A0A8C7UTW0_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss (length=441 residues).
tcaccatccagggaaggtacctaccttcccaaggacatcaccctcactcatgtttgcgctatggatgttacaggtatgat
caacacactctatgtggatgacagaggggataacgtgaagttccttagtgcagtagcccatagcatctttgaagacggga
ccgtcaactggggccgtgttgccagcctgacatcttttggggctgcggtgtgccggtacttgagaggcaaggggagagac
aactgtgtggatttggtgggagaggagatatcagagtacctggtcactcaccacaaggactggctagtcaaacataactc
ctggactgggttcgtggagttctttccagtagcagaacctgagtccagatgtcggaacatcattatgaccatttttggat
tggctggtattggggcaacaatgaccttcttggttatgtga
>gnl|bcl2dbcds|A0A8C7V132_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Oncorhynchus mykiss (length=723 residues).
atgccattttttgtgacgtcgcttagtgagtataaagtctggcgagagcctggtgaggcggaaatacggttgatgacagc
gatcctccttccgtctgtacgtggagaaagcagtctgatcgctgggaggaccatgtcatgcgggctgtggaaagaaaccc
tggcaatagcagaggactacctgtctgtctgcagtattatccctgccagtgggtcccggaaagccccgcctggtcctcct
cccagcgactcggctgcagccatgcggcgccaggcccgggacatggaggccaagcaccgggcccgcttccatgccctggc
acacagcttcctgtgccaatgcgggccggacccctgcgcctgtctgaggagggtgatggaggagctggtgggagatggac
agatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggtcagagaactacagggagaggacacagac
caggggctgggtaatggcatggagctgggggggaaggagagctgcagggcactggcggagaccatagcagactacctagg
agaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgtaagttcttccacacagcaagagaggtga
accaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcatcgcagggttaaccttcctcctggtccgc
taa
>gnl|bcl2dbcds|A0A8K9UQL8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus mykiss (length=582 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaattggatatgcgtgggattt
cgagaatgcagaggaagatgctgataataatgggtcgatgatttctcctccgcctgctattcacagagttttgcgtgagg
ccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcacgtcttctatggca
gaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtcgccttcttcgagtt
cggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgctgggtggatgacggagt
atctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctctatgacagacagagg
gactccgtgttctgttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaagccttaccatcgg
agcttaccttacacagaagtga
>gnl|bcl2dbcds|A0A8K9X1Z8_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Oncorhynchus mykiss (length=723 residues).
atgccattttttgtgacgttgcttagtgagtataaagtctggcgagagcctggtgaggcggaaatacggttgatgacagc
gatcctccttccgtctgtacgtggagaaagcagtctgatcgctgggaggaccatgtcatgcgggctgtggaaagaaaccc
tggcaatagcagaggactacctgtctgtctgcagtattatccctgccagtgggtcccggaaagccccgcctggtcctcct
cccagcgactcggctgcagccatgcggcgccaggcccgggacatggaggccaagcaccgggcccgcttccatgccctggc
acacagcttcctgtgccaatgcgggccggacccctgcgcctgtctgaggagggtgatggaggagctggtgggagatggac
agatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggtcagagaactacagggagaggacacagac
caggggctgggtaatggcatggagctgggggggaaggagagctgcagggcactggcggagaccatagcagactacctagg
agaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgtaagttcttccacacagcaagagaggtga
accaggactcgtccatgaaaactgccctgtttgctgctgctggcgtgggcatcgcagggttaaccttcctcctggtccgc
taa
© 1998-2023Legal notice