Dataset for CDS BAX-like of Organism Catagonus wagneri

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C3VXM4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Catagonus wagneri GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcctggagcaggtgccccaggacg
cgtctaccaagaagctgagcgagtgtctcaagcgcattggagatgaactggacagtaacatggagctgcaaaggatgatt
gcagctgtggacacggactccccccgagaggtctttttccgagtggcggccgaaatgtttgccgacggcaacttcaactg
gggccgggttgtggcgcttttctactttgccagcaaactggtgctcaaggccctgtgcaccagggttcccgaactgatca
ggaccatcatgggctggacactggacttcctgcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A8C3VXM4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Catagonus wagneri GN=BAX (length=432 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgcagctgtggacacggactccccccgagaggtctttttccgagtggcggccgaaatgtttgccgacg
gcaacttcaactggggccgggttgtggcgcttttctactttgccagcaaactggtgctcaaggccctgtgcaccagggtt
cccgaactgatcaggaccatcatgggctggacactggacttcctgcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctcaccg
cctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A8C3W4C3_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Catagonus wagneri GN=BAK1 (length=636 residues).
atggcgtccggccaaggcccgggtccccccaggcagggctgcggagagcccgacccctcgtccacatcagaggaacaggt
ggcccgggacacggaggaggttttccgcagctacgtttttcaccgctatcagcaggagcaagaggccgagggggcagctg
cgcccactgacccagagatggtcaccctgcccctagaaccgagcagcaccatggggcaggtgggccgccagctcgccatc
attggggacgacatcaaccggcgatatgactcggagttccaggccatgctgcagcacctgcagccaacagcggaaaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagcggcatcaactggggtcgagtagtggctcttctgggct
ttggctaccgcctggccctgtatgtctaccagaggggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgttgcatcactgcatcgcccggtggatcgctcagaggggtggctgggtggcagccctagatttgggaaacggccc
catccggaatgtgctgctagttctggctgtggttttgctgggccagtttgtggtacgcagatttttcaggtcatga
>gnl|bcl2dbcds|A0A8C3WKL3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Catagonus wagneri GN=BOK (length=642 residues).
atggaagtgctgcgccgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggaacgcgcccg
agcgcgccgcgcccgcccccggcggccgtctggccgaggtgtgcgcggtgctgctgcgcctggcggacgagctggagctg
attcgccccagcgtctatcgcaacgtggcccgccagctgaacatctccctgcagtctgagactgtggtgaccgacgcctt
cctcgccgtggcggcccagatcttctctgcagggatcacgtggggcaaggtggtggccctgtactcagtggccgcagggc
tggccgtggactgcgtgcggcaggcccagcctgccatggtccacgccctcgtcgactgcctcggggagttcgtgcgcaag
accctggcgtcctggctgcggaggcgcggcggatggacggatgtcctcaagtgcgtggtcagtgccgaccctggtctccg
ctcccactggctcgtggccgcgctctgcagcttcggccgcttcctgaagggtgccttcttcgtgctgctgccggagagat
ga
© 1998-2023Legal notice