Dataset for CDS BAX-like of Organism Catagonus wagneri

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3WKL3_BOK-01       atgga--agtgctg--------cgccgctcctcggtcttcgccgccgaga
A0A8C3W4C3_BAK1-01      atggc---gtccggccaaggcccgggtccccccaggcagggctgcggaga
A0A8C3VXM4_BAX-01       atggacgggtccgg---------ggagcaacccaga------ggcggggg
A0A8C3VXM4_BAX-02       atggacgggtccgg---------ggagcaacccaga------ggcggggg
                        ****    ** * *         *   *  * * *        ** * * 

A0A8C3WKL3_BOK-01       tcatggacgcctttgaccgctc-gcccaccgacaaggagctggtggccca
A0A8C3W4C3_BAK1-01      gc----------ccgacccctc-gtccacatcagaggaacaggtggcccg
A0A8C3VXM4_BAX-01       gc----------ccaccagctctgagcagatcatgaagacaggggccct-
A0A8C3VXM4_BAX-02       gc----------ccaccagctctgagcagatcatgaagacaggggccct-
                         *              *  *** *  **           * ** * **  

A0A8C3WKL3_BOK-01       ggccaaggcg---------ctcggccgggagttcgtgcacgcgcggctgc
A0A8C3W4C3_BAK1-01      ggacacggaggaggttttccgcagctacgtttttcaccgctatcagcagg
A0A8C3VXM4_BAX-01       --------------tttgcttcag----ggtttcatccaggatcgagcag
A0A8C3VXM4_BAX-02       --------------tttgcttcag----g---------------------
                                             * *    *                     

A0A8C3WKL3_BOK-01       tgcgcgccggcctcgcctggaacgcgcccgagcgcgccgcgcccgccccc
A0A8C3W4C3_BAK1-01      agcaag------aggccgagggggcagctgcgcccactgacccagagatg
A0A8C3VXM4_BAX-01       ggcgaa------tggggggagagacacccgagc---tgggcctggagcag
A0A8C3VXM4_BAX-02       --------------------------------------------------
                                                                          

A0A8C3WKL3_BOK-01       ggcggccgtctggccgaggtgtgcgcggtgctgctgcgcctggcggacga
A0A8C3W4C3_BAK1-01      gtcaccctgcccctagaaccgagcagcaccatggggcaggtgggccgcca
A0A8C3VXM4_BAX-01       gtgccc------------caggacgcgtctaccaagaagctgagcgagtg
A0A8C3VXM4_BAX-02       --------------------------------------------------
                                                                          

A0A8C3WKL3_BOK-01       gctggagctgattcgccccagcgtctatcg------caacgtggcccgcc
A0A8C3W4C3_BAK1-01      gctcgccatcattggggacgacatcaaccggcgatatgactcggagttcc
A0A8C3VXM4_BAX-01       tctcaagcgcattggagatgaactggacag------taacatggagctgc
A0A8C3VXM4_BAX-02       --------------------------------------------------
                                                                          

A0A8C3WKL3_BOK-01       agctgaacatctccctgcagtctgagactgtggtgaccgacgc-------
A0A8C3W4C3_BAK1-01      a---ggccatgctgcagcacctgcagccaacagcggaaaacgcctatgag
A0A8C3VXM4_BAX-01       a---aaggatgatt--gcagctgtggaca----cggactccccccgagag
A0A8C3VXM4_BAX-02       ------ggatgatt--gcagctgtggaca----cggactccccccgagag
                                **      ***      * *      *     * *       

A0A8C3WKL3_BOK-01       --cttcctcgccgtggcggcccagatcttctctgcaggga---tcacgtg
A0A8C3W4C3_BAK1-01      tacttcaccaagattgcctccagcctgtttgagagcggca---tcaactg
A0A8C3VXM4_BAX-01       gtctttttccgagtggcggccgaaatgtttgccgacggcaacttcaactg
A0A8C3VXM4_BAX-02       gtctttttccgagtggcggccgaaatgtttgccgacggcaacttcaactg
                          ***   *    * **  **    * **       ** *   ***  **

A0A8C3WKL3_BOK-01       gggcaaggtggtggccc---tgtactcagtggccgcagggctggccgtgg
A0A8C3W4C3_BAK1-01      gggtcgagtagtggctcttctgggct--------------ttggctaccg
A0A8C3VXM4_BAX-01       gggccgggttgtggcgcttttctact--------------ttgccagcaa
A0A8C3VXM4_BAX-02       gggccgggttgtggcgcttttctact--------------ttgccagcaa
                        ***    ** ***** *   *   **               ** *     

A0A8C3WKL3_BOK-01       actgcgtgcggcaggcccagcctgccatggtccacgccctcgtcgactgc
A0A8C3W4C3_BAK1-01      cctg-gccctgta-----tgtctaccagagg----ggcctga--------
A0A8C3VXM4_BAX-01       actg-gtgctcaaggccctgtgcaccagggttcccgaactga--------
A0A8C3VXM4_BAX-02       actg-gtgctcaaggccctgtgcaccagggttcccgaactga--------
                         *** *  *   *      *    ***  *     *  **          

A0A8C3WKL3_BOK-01       ctcggggagttcgtgcgcaagaccctggcgtcctggctgcggaggcg---
A0A8C3W4C3_BAK1-01      -ccgg---cttcctgggccaggt----g---acccgcttcgtggccgact
A0A8C3VXM4_BAX-01       -tcaggaccatcatgggctggacactgg---acttcctgcgagagcggct
A0A8C3VXM4_BAX-02       -tcaggaccatcatgggctggacactgg---acttcctgcgagagcggct
                          * *     ** ** **  *      *    *   ** **    **   

A0A8C3WKL3_BOK-01       -------------------cggcggatggacggatgtcctcaagtgcgtg
A0A8C3W4C3_BAK1-01      tcatgttgcatcactgcatcgcccggtggat-----cgctcagaggggtg
A0A8C3VXM4_BAX-01       gctgg-------------------gctggat-----ccaggaccagggtg
A0A8C3VXM4_BAX-02       gctgg-------------------gctggat-----ccaggaccagggtg
                                                * ****           *   * ***

A0A8C3WKL3_BOK-01       gtcagtgccgaccctggtctccgctcccac--tggctcgtggccgcgctc
A0A8C3W4C3_BAK1-01      gctggg-t-------ggcagcc---ctagatttgggaaacggccccat-c
A0A8C3VXM4_BAX-01       gttgggac-------ggcctcctctcctactttgggacac--ccacgtgg
A0A8C3VXM4_BAX-02       gttgggac-------ggcctcctctcctactttgggacac--ccacgtgg
                        *   *          **   **   *      ***       ** *    

A0A8C3WKL3_BOK-01       tgcagcttcggccgcttcctgaagggtgcctt-----cttcgtgctgctg
A0A8C3W4C3_BAK1-01      cggaatgtgctgctagttctggctgtggtttt-----gctgggccagttt
A0A8C3VXM4_BAX-01       cagacagtgaccatctttgtggccggagtgctcaccgcctcgctcaccat
A0A8C3VXM4_BAX-02       cagacagtgaccatctttgtggccggagtgctcaccgcctcgctcaccat
                           *   *        *  **   *  *   *       * *  *     

A0A8C3WKL3_BOK-01       ccgg---------------agagatga
A0A8C3W4C3_BAK1-01      gtggtacgcagatttttcaggtcatga
A0A8C3VXM4_BAX-01       ctgg-aagaagat------gggc-tga
A0A8C3VXM4_BAX-02       ctgg-aagaagat------gggc-tga
                          **                *   ***

© 1998-2023Legal notice