Dataset for CDS BCL2L2 of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5MZX9_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A2K5MZX9_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A2K5MZX9_BCL2L2-      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
A0A2K5MZX9_BCL2L2-      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
                        ****** *  * **  ****  ***   ** ****  ***  *** * * 

A0A2K5MZX9_BCL2L2-      ---ggggctccgggccggggcggcggcgccatcttgtgcccggggccggt
A0A2K5MZX9_BCL2L2-      ---ggggctccgggccggggcggcggcgccatcttgtgcccggggccggt
A0A2K5MZX9_BCL2L2-      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
A0A2K5MZX9_BCL2L2-      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
                             ** *    ** * *** *  * *  *   ***    ** ** ** 

A0A2K5MZX9_BCL2L2-      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
A0A2K5MZX9_BCL2L2-      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
A0A2K5MZX9_BCL2L2-      cctggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
A0A2K5MZX9_BCL2L2-      cctggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
                            ***  ****  * **  * ***     *  ***     * * * * 

A0A2K5MZX9_BCL2L2-      acggcctg----gagtctgag------------------------gaact
A0A2K5MZX9_BCL2L2-      acggcctg----gagtctgag------------------------gaact
A0A2K5MZX9_BCL2L2-      gcagctggagatgagttcgagacccgcttccggcgcaccttctctgatct
A0A2K5MZX9_BCL2L2-      gcagctggagatgagttcgagacccgcttccggcgcaccttctctgatct
                         * **  *    ****  ***                        ** **

A0A2K5MZX9_BCL2L2-      ggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaag
A0A2K5MZX9_BCL2L2-      ggagcctgagga--------------------------------------
A0A2K5MZX9_BCL2L2-      ggcggctcagctgcatgtg-----------accccaggctcagcacagca
A0A2K5MZX9_BCL2L2-      ggcggctcagctgcatgtg-----------accccaggctcagcacagca
                        ** * ** **                                        

A0A2K5MZX9_BCL2L2-      aggagccgccccggcccc------gcgcccccccgggagctccg------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      acgcttcacccaggtctccgatgaacttttccaagggggccccaactggg
A0A2K5MZX9_BCL2L2-      acgcttcacccaggtctccgatgaacttttccaagggggccccaactggg

A0A2K5MZX9_BCL2L2-      ----------ggccctgggcctggttcgggagcccccggcagccaagag-
A0A2K5MZX9_BCL2L2-      ------------------------------------------ccaagag-
A0A2K5MZX9_BCL2L2-      gccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagt
A0A2K5MZX9_BCL2L2-      gccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagt
                                                                  *  **** 

A0A2K5MZX9_BCL2L2-      ------gaggaggaggagcc------gggac--------tggtcgagggt
A0A2K5MZX9_BCL2L2-      ------gaggaggaggagcc------gggac--------tggtcgagggt
A0A2K5MZX9_BCL2L2-      gtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggt
A0A2K5MZX9_BCL2L2-      gtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggt
                               *****  *** **      *****          ** ** ***

A0A2K5MZX9_BCL2L2-      gac---ccgggggacggcgc-------------------cattgaggacc
A0A2K5MZX9_BCL2L2-      gac---ccgggggacggcgc-------------------cattgaggacc
A0A2K5MZX9_BCL2L2-      ggcctacctggagacgcggctggctgactggatccacagcagtgggggct
A0A2K5MZX9_BCL2L2-      ggcctacctggagacgcggctggctgactggatccacagcagtgggggct
                        * *   ** ** ****  **                   ** ** ** * 

A0A2K5MZX9_BCL2L2-      cggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
A0A2K5MZX9_BCL2L2-      cggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
A0A2K5MZX9_BCL2L2-      gggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
A0A2K5MZX9_BCL2L2-      gggcg------gagttcacagctctatacgggg-----------------
                         ** *      *   *** ***** *  * ***                 

A0A2K5MZX9_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgag
A0A2K5MZX9_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgag
A0A2K5MZX9_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgag
A0A2K5MZX9_BCL2L2-      ----------------------acgggg----------------------
                                              *** **                      

A0A2K5MZX9_BCL2L2-      tccacctccaggcaatgctggcccagtgatcatgtccattgaggagaaga
A0A2K5MZX9_BCL2L2-      tccacctccaggcaatgctggcccagtgatcatgtccattgaggagaaga
A0A2K5MZX9_BCL2L2-      tccacctccaggcaatgctggcccagtgatcatgtccattgaggagaaga
A0A2K5MZX9_BCL2L2-      -----------------------------------ccctggaggaggcg-
                                                           ** * ******  * 

A0A2K5MZX9_BCL2L2-      tggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
A0A2K5MZX9_BCL2L2-      tggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
A0A2K5MZX9_BCL2L2-      tggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
A0A2K5MZX9_BCL2L2-      cggcgtctg-----------------------------------------
                         ** * ***                                         

A0A2K5MZX9_BCL2L2-      acagcagaagagctggaagctcactttcatggctgtggatcagtcaaccg
A0A2K5MZX9_BCL2L2-      acagcagaagagctggaagctcactttcatggctgtggatcagtcaaccg
A0A2K5MZX9_BCL2L2-      acagcagaagagctggaagctcactttcatggctgtggatcagtcaaccg
A0A2K5MZX9_BCL2L2-      -cgggaggggaactgg----------------------------------
                         * * **  ** ****                                  

A0A2K5MZX9_BCL2L2-      tgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcgt
A0A2K5MZX9_BCL2L2-      tgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcgt
A0A2K5MZX9_BCL2L2-      tgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcgt
A0A2K5MZX9_BCL2L2-      --------------------------------------------------

A0A2K5MZX9_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccttggccttagat
A0A2K5MZX9_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccttggccttagat
A0A2K5MZX9_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccttggccttagat
A0A2K5MZX9_BCL2L2-      --------------------gcatcagtgaggac----------------
                                            *  ***********                

A0A2K5MZX9_BCL2L2-      gagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaa
A0A2K5MZX9_BCL2L2-      gagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaa
A0A2K5MZX9_BCL2L2-      gagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaa
A0A2K5MZX9_BCL2L2-      -----------------------------agtg-----------------

A0A2K5MZX9_BCL2L2-      cagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
A0A2K5MZX9_BCL2L2-      cagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
A0A2K5MZX9_BCL2L2-      cagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
A0A2K5MZX9_BCL2L2-      --------------------ctgacggggg--------------------
                                            * *** ****                    

A0A2K5MZX9_BCL2L2-      gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggt
A0A2K5MZX9_BCL2L2-      gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggt
A0A2K5MZX9_BCL2L2-      gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggt
A0A2K5MZX9_BCL2L2-      -------------------------------------------ccgtggc
                                                                   * **** 

A0A2K5MZX9_BCL2L2-      tttaacagcaggccccggggtcgtgtctacaggggccgggctagagcgac
A0A2K5MZX9_BCL2L2-      tttaacagcaggccccggggtcgtgtctacaggggccgggctagagcgac
A0A2K5MZX9_BCL2L2-      tttaacagcaggccccggggtcgtgtctacaggggccgggctagagcgac
A0A2K5MZX9_BCL2L2-      ----actgggggccctg-----gtaactgtaggggcc-------------
                            ** *  ***** *     **  **  *******             

A0A2K5MZX9_BCL2L2-      atcatggtattccccttac---taa
A0A2K5MZX9_BCL2L2-      atcatggtattccccttac---taa
A0A2K5MZX9_BCL2L2-      atcatggtattccccttac---taa
A0A2K5MZX9_BCL2L2-      -------ttttttgctagcaagtga
                               * **   **  *   * *

© 1998-2022Legal notice