Dataset for CDS BCL-2-like of organism Sparus aurata

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671XUH4_BCL2L10      atgt-----------------------------gcagagagca-------
A0A671VEU3_MCL1-02      atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttca
A0A671VEU3_MCL1-01      atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttca
A0A671VEU3_MCL1-03      atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttca
A0A0B4KJI5_BCL2L1-      atgtcgt--------------------acagtaacagagagct-------
A0A671WXV0_BCL2L1-      atgtcac--------------------aa---aacagagaact-------
                        ****                                  ** *        

A0A671XUH4_BCL2L10      --------------------------------------------------
A0A671VEU3_MCL1-02      aaatggagtcgtaggtggaacgatgcactacgactcaagagattccgctc
A0A671VEU3_MCL1-01      aaatggagtcgtaggtggaacgatgcactacgactcaagagattccgctc
A0A671VEU3_MCL1-03      aaatggagtcgtaggtggaacgatgcactacgactcaagagattccgctc
A0A0B4KJI5_BCL2L1-      -agtggagtcctttttaag-------------------------------
A0A671WXV0_BCL2L1-      -ggtggttttctacataaa-------------------------------
                                                                          

A0A671XUH4_BCL2L10      ---------------------gtctgatatcgctgggaggaa--------
A0A671VEU3_MCL1-02      cggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcggg
A0A671VEU3_MCL1-01      cggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcggg
A0A671VEU3_MCL1-03      cggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcggg
A0A0B4KJI5_BCL2L1-      ---------------------ctacaaactgtctcagaggaactat----
A0A671WXV0_BCL2L1-      ---------------------ctataaactctcccagagaaactat----
                                              *      *  *     *  *        

A0A671XUH4_BCL2L10      --------------------------------------------------
A0A671VEU3_MCL1-02      tctaacgacacgccgaaacggccgattaaccttggagtgaacacggcgaa
A0A671VEU3_MCL1-01      tctaacgacacgccgaaacggccgattaaccttggagtgaacacggcgaa
A0A671VEU3_MCL1-03      tctaacgacacgccgaaacggccgattaaccttggagtgaacacggcgaa
A0A0B4KJI5_BCL2L1-      ---------------------ccaactgccct-------------gctga
A0A671WXV0_BCL2L1-      ---------------------cctctcaacca-------------catgg
                                                                          

A0A671XUH4_BCL2L10      -----------------------aatgtcgtgcgggctgtggaaagagac
A0A671VEU3_MCL1-02      ggcgtataatgtaccgaaaaacctccgggaggacagc-gaggacctcgag
A0A671VEU3_MCL1-01      ggcgtataatgtaccgaaaaacctccgggaggacagc-gaggacctcgag
A0A671VEU3_MCL1-03      ggcgtataatgtaccgaaaaacctccgggaggacagc-gaggacctcgag
A0A0B4KJI5_BCL2L1-      gg------------ccagatgatgctggtggaaggactgaggcagacaaa
A0A671WXV0_BCL2L1-      gactcatagagtctccaaacaggactgatgggggggc-gacgcacgccaa
                                                  *         * *  *      * 

A0A671XUH4_BCL2L10      cctggctc-----------------------tggcagaggactacctg--
A0A671VEU3_MCL1-02      gacggctctttaccgtgtactccagagctacagtccgaaaacgacatgga
A0A671VEU3_MCL1-01      gacggctctttaccgtgtactccagagctacagtccgaaaacgacatgga
A0A671VEU3_MCL1-03      gacggctctttaccgtgtactccagagctacagtccgaaaacgacatgga
A0A0B4KJI5_BCL2L1-      gccaactc-----------------agctgccac----aaatggcctg--
A0A671WXV0_BCL2L1-      tgggactt-------------------------t----taacggcatgag
                             **                                 *   * **  

A0A671XUH4_BCL2L10      tccctgtgctgcacaagcccccggccagcccctccacctcccagcga---
A0A671VEU3_MCL1-02      tatctccagttgtccagcaggggacgagcttctggatcaagacacaaggc
A0A671VEU3_MCL1-01      tatctccagttgtccagcaggggacgagcttctggatcaagacacaaggc
A0A671VEU3_MCL1-03      tatctccagttgtccagcaggggacgagcttctggatcaagacacaaggc
A0A0B4KJI5_BCL2L1-      --ctgg-------ccaaca---------------------gcagcaacgg
A0A671WXV0_BCL2L1-      tcctggcacacccccagca----------tcccctcttcggcagcaacgg
                                     * * *                          * *   

A0A671XUH4_BCL2L10      -----gtcagccg----ctgcca---------------------------
A0A671VEU3_MCL1-02      aattgatcagccggttcctggcagtgtatacaggactttctaaacttcgg
A0A671VEU3_MCL1-01      aattgatcagccggttcctggcagtgtatacaggactttctaaacttcgg
A0A671VEU3_MCL1-03      aattgatcagccggttcctggcagtgtatacaggactttctaaacttcgg
A0A0B4KJI5_BCL2L1-      gggcggacagccaggtgctgaca---------------------------
A0A671WXV0_BCL2L1-      ttgccgtcaacaa----caagcc---------------------------
                               ** *      *   *                            

A0A671XUH4_BCL2L10      tg----------------------------aggtgcatggcccaggacat
A0A671VEU3_MCL1-02      tggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgt
A0A671VEU3_MCL1-01      tggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgt
A0A671VEU3_MCL1-03      tggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgt
A0A0B4KJI5_BCL2L1-      tagaggctgttaaagcagctct--------tcgggactcatctgaagagt
A0A671WXV0_BCL2L1-      tggacgcagtgaaagaagccct--------acgggactctgccaatgagt
                        *                               * *  *           *

A0A671XUH4_BCL2L10      ggaggcgcagca--ccaggctcgcttccactccctcgccca--------g
A0A671VEU3_MCL1-02      tttggaaaagc---acagatacgcgtacaatggtatggtcaaaaaatt-g
A0A671VEU3_MCL1-01      tttggaaaagc---acagatacgcgtacaatggtatggtcaaaaaatt-g
A0A671VEU3_MCL1-03      tttggaaaagc---acagatacgcgtacaatggtatggtcaaaaaatt-g
A0A0B4KJI5_BCL2L1-      tt--gaactgctcttcacacaagcgtttagtgacctctccacgcagctcg
A0A671WXV0_BCL2L1-      tc--gagctgcgatatgcgcgcgccttcagcgacctgcacaaccagctgc
                            *    **           ** *  *          **         

A0A671XUH4_BCL2L10      acctt---cctgaggcagtgcgggcctgacccctgctccagcctcaggaa
A0A671VEU3_MCL1-02      acactggatgagagggag-------------gatgc--aagttttgtcag
A0A671VEU3_MCL1-01      acactggatgagagggag-------------gatgc--aagttttgtcag
A0A671VEU3_MCL1-03      acactggatgagagggag-------------gatgc--aagttttgtcag
A0A0B4KJI5_BCL2L1-      acatcactcctgacacag-------------cctaccacagctttaagag
A0A671WXV0_BCL2L1-      acatcacaccggccacag-------------cctaccaaagcttcgaaaa
                        **         *    **               * *   **  *    * 

A0A671XUH4_BCL2L10      ggtgatagaggagc---tggtgggagatggacacttgaactgggggaggg
A0A671VEU3_MCL1-02      ctcagtagccaagagcctttttgcagacgggaccacaaactggggccggg
A0A671VEU3_MCL1-01      ctcagtagccaagagcctttttgcagacgggaccacaaactggggccggg
A0A671VEU3_MCL1-03      ctcagtagccaagagcctttttgcagacgggaccacaaactggggccggg
A0A0B4KJI5_BCL2L1-      cgtgatggacgagg---tgttcaaggacggagtc---aactggggacgtg
A0A671WXV0_BCL2L1-      cgtgatggacgagg---tgttccgggacggagtc---aactggggtcgtg
                             * *   **    *  *    ** **   *   ********  * *

A0A671XUH4_BCL2L10      ttgtttcccttttcacctttactggggtgctggccagacagctgcaggag
A0A671VEU3_MCL1-02      tcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaagg--
A0A671VEU3_MCL1-01      tcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaagg--
A0A671VEU3_MCL1-03      tcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaagg--
A0A0B4KJI5_BCL2L1-      tagtgggcctgtttgcttttggcggtgtgctgtgtgtggaatgcgttg--
A0A671WXV0_BCL2L1-      tagtagggctttttgctttcggtggagcgctgtgcgtggagtgcatgg--
                        * **    **  *  * **    *  * * **       *       *  

A0A671XUH4_BCL2L10      cagaaggacaagaagccggggctggaacccgggcaggaactgggacaggg
A0A671VEU3_MCL1-02      -agaaaggcaggggccactgtgtggagc----------------------
A0A671VEU3_MCL1-01      -agaaaggcaggggccactgtgtggagc----------------------
A0A671VEU3_MCL1-03      -agaaaggcaggggccactgtgtggagc----------------------
A0A0B4KJI5_BCL2L1-      -agaaggatacgagcgagctggtctccc----------------------
A0A671WXV0_BCL2L1-      -agaaggagatgagtccgctggtcggca----------------------
                         **** *  * *          *                           

A0A671XUH4_BCL2L10      gcctggaaactgcaggggactggcagagaccatagctgattacctgggag
A0A671VEU3_MCL1-02      -----------------aggtgggacaggagatctcgacctacctgctga
A0A671VEU3_MCL1-01      -----------------aggtgggacaggagatctcgacctacctgctga
A0A671VEU3_MCL1-03      -----------------aggtgggacaggagatctcgacctacctgctga
A0A0B4KJI5_BCL2L1-      -----------------gcatcgcagactggatgaccatgtacctg--ga
A0A671WXV0_BCL2L1-      -----------------ggatcatagagtggatgacggtctacctg--ga
                                            *   * *    **  *    ******    

A0A671XUH4_BCL2L10      aggagaagaaaga---gtggct----gctggagaatgacggatgggaggg
A0A671VEU3_MCL1-02      cggagcagagaga---ctggct----ggtcaagaacaactcttgggatgg
A0A671VEU3_MCL1-01      cggagcagagaga---ctggct----ggtcaagaacaactcttgggatgg
A0A671VEU3_MCL1-03      cggagcagagaga---ctggct----ggtcaagaacaactcttgggatgg
A0A0B4KJI5_BCL2L1-      t-gagcacatcaatccgtggattgagagccaaggagga----tgggactc
A0A671WXV0_BCL2L1-      c-aaccacattcagccctggatccagagccaaggagga----tgggagcg
                           *  * *   *    *** *         ** *  *    *****   

A0A671XUH4_BCL2L10      gttctgtaagttctcc--------cgcagtgccagagaggtgagtcagga
A0A671VEU3_MCL1-02      ctttgttgagttcttcag---agtagcagatccagagtccacagtgagga
A0A671VEU3_MCL1-01      ctttgttgagttcttcag---agtagcagatccagagtccacagtgagga
A0A671VEU3_MCL1-03      ctttgttgagttcttcag---agtagcagatccagagtccacagtgagga
A0A0B4KJI5_BCL2L1-      ctttgctgaggtttttgggcgagacgcagctgcagaa------gcgagga
A0A671WXV0_BCL2L1-      ctttgctgaaatcttcgggcaggacgcggcggcagag------agcagga
                         **   * *  * *           ** *   ****          ****

A0A671XUH4_BCL2L10      atcgtccatgaaga-----aagcgctgtttgctgccgctggtg------t
A0A671VEU3_MCL1-02      a--cactctcatggcatttgctggat--ttgctggtattggagcaacgct
A0A671VEU3_MCL1-01      a--cactctcatggcatttgctggat--ttgctggtattggagcaacgct
A0A671VEU3_MCL1-03      a--cactctcatggcatttgctggat--ttgctggtattggagcaacgct
A0A0B4KJI5_BCL2L1-      g--atctcgggagactctgagtcggtggctgctgg--ttggag------t
A0A671WXV0_BCL2L1-      g--gtctcaggagagtttcaagaagtggctgctgg--cgggga------t
                             *      *            *   *****     **        *

A0A671XUH4_BCL2L10      aggcat-----------------------------cgctggactcacctt
A0A671VEU3_MCL1-02      tgccctgttgatcagcccgagggtgagtcgaggagaagttcatgagatga
A0A671VEU3_MCL1-01      tgccctgttgatcag------------------------gtgtgatcttc
A0A671VEU3_MCL1-03      tgccctgttgatcag-----------------------------------
A0A0B4KJI5_BCL2L1-      ggcgctgctaatggg--------------------agttgtgctcggtgt
A0A671WXV0_BCL2L1-      gaccctggtgaccgg--------------------ggtcgtggtgggctc
                             *                                            

A0A671XUH4_BCL2L10      cctcctggtgcgctag---------
A0A671VEU3_MCL1-02      cctcatcgtcggcaga-----ataa
A0A671VEU3_MCL1-01      gactctcacgaccgga-----gtga
A0A671VEU3_MCL1-03      ---------------------gtga
A0A0B4KJI5_BCL2L1-      cctcatcgctaagaaaca---gtga
A0A671WXV0_BCL2L1-      actcatcgcccagaaacgcctgtga
                                                 

© 1998-2020Legal notice