Dataset for CDS BCL-2-like of organism Lynx canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A667GHH0_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaa
A0A667HQV5_BCL2A1-      atggcgg-------------------------------------------
A0A667GW69_BCL2L10      atggctgacgc------------gttgagggagcgccgcctattgactga
A0A667GXX5_MCL1-01      atgtttggc-c------------tcaaaagaaacgctgtaatcggactca
A0A667GXX5_MCL1-02      atgtttggc-c------------tcaaaagaaacgctgtaatcggactca
A0A667HK09_BCL2L1-      atgtc------------------tcagagcaaccgggagctggtggttga
A0A667I624_BCL2L2-      atggcgaccccagcctcagc--cccagacaca-cgggctctagtggcaga
A0A667I624_BCL2L2-      atggcggcggcggcggcggc--ggcagcagcagcgggggct----gcggg

A0A667GHH0_BCL2-01      gtacatcc------------------actataagctgtcgcagaggggct
A0A667HQV5_BCL2A1-      --------------------------acggcgagtttgggta----cgtt
A0A667GW69_BCL2L10      ctacctggagtactgcgcccgggaccccggcagccccgcgcg--gacgcc
A0A667GXX5_MCL1-01      acctctactgtgggggggccggg---ttggcggccgggagcggcggcgcc
A0A667GXX5_MCL1-02      acctctactgtgggggggccggg---ttggcggccgggagcggcggcgcc
A0A667HK09_BCL2L1-      ctttctct------------------cctacaagctttcccagaaaggat
A0A667I624_BCL2L2-      ctttgtag------------------gctataagctgaggcagaagggtt
A0A667I624_BCL2L2-      cggtcggg------------------gctccgggccggggcggcggcgcc

A0A667GHH0_BCL2-01      acgagtgggatgccggggacgcgggcgccgcgcccggggccgcccccgcg
A0A667HQV5_BCL2A1-      ctcacgc---tgacccgggactatatga----------------------
A0A667GW69_BCL2L10      gt--cca---cgcccgaggccgcggtgc----------------------
A0A667GXX5_MCL1-01      tc--ctc---ttcgggagggcggcttgtggctgtggggaaggaggccacg
A0A667GXX5_MCL1-02      tc--ctc---ttcgggagggcggcttgt----------------------
A0A667HK09_BCL2L1-      acagctg---------gagtcagtttagtgatgtggaagagaacagaact
A0A667I624_BCL2L2-      atgtttg---tg------------gagcaggccctggggagggcccagca
A0A667I624_BCL2L2-      at-cttg---tgcccggggccggtggggaggccggggagggggccc--cg

A0A667GHH0_BCL2-01      ccgggc--------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A667GW69_BCL2L10      --------------------------------------------------
A0A667GXX5_MCL1-01      gccaggcgagaggtagggggaggggaagccggtgcggtgattggcggaag
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      gaggccccag------aagggactgaatcagagatggaga----------
A0A667I624_BCL2L2-      gctgacccactgcaccaagcca--tgcgtgcagctggaga----tgagtt
A0A667I624_BCL2L2-      gggggcgcaggggactacgggaacggcctggagtctgaggaactggagcc

A0A667GHH0_BCL2-01      --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A667GW69_BCL2L10      --------------------------------------------------
A0A667GXX5_MCL1-01      cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A667I624_BCL2L2-      tg------------------------------------------------
A0A667I624_BCL2L2-      tg------------------------------------------------

A0A667GHH0_BCL2-01      --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A667GW69_BCL2L10      --------------------------------------------------
A0A667GXX5_MCL1-01      cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccccc
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------

A0A667GHH0_BCL2-01      --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A667GW69_BCL2L10      --------------------------------------------------
A0A667GXX5_MCL1-01      ccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaaa
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------

A0A667GHH0_BCL2-01      ------atcttctcctcccagcccgggcgcacccctgcgcccgccaggac
A0A667HQV5_BCL2A1-      ------agcacgttctgcaggggc-------------------ccca---
A0A667GW69_BCL2L10      -------------------tgcgc---------tacctggccgcccagat
A0A667GXX5_MCL1-01      gatggaaggcccagccgccgacgc---------catcatgtcgcccgaag
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------cccccagtgc-------catcaatggcaaccca---
A0A667I624_BCL2L2-      ------a-gacccgcttccggcgcaccttctctgatttggcagcccagtt
A0A667I624_BCL2L2-      ------aggagctgctgctggagc-------ccgagccgg-agcccg---

A0A667GHH0_BCL2-01      c-------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A667GW69_BCL2L10      a-------------------------------------------------
A0A667GXX5_MCL1-01      aggagctagacgggtacgagccagaacctctggggaagcggccggctgtc
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A667I624_BCL2L2-      g---------------------catgtgacccctgggtcagcccagcaac
A0A667I624_BCL2L2-      ---------------------------------------agcccgaagag

A0A667GHH0_BCL2-01      --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A667GW69_BCL2L10      --------------------cggcagcgccaccagcgtttcttgt-----
A0A667GXX5_MCL1-01      ctgcctttgctggagttggtcggggaggccagcagtggccccggcacaga
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      ------tcctggcacttggcggaca-------------------------
A0A667I624_BCL2L2-      gcttcacccaggtctctgatgaactcttccaagggggccccaactggggc
A0A667I624_BCL2L2-      gagccgccccggcccc------gcgcccccccgggagctccgg-------

A0A667GHH0_BCL2-01      -tccccgccgccgcccccg-------------------------------
A0A667HQV5_BCL2A1-      -gccc---------------------------------------------
A0A667GW69_BCL2L10      cggcttaccgc---------------------------------------
A0A667GXX5_MCL1-01      cggctcactgccctcgacgccacccccagcagaggaggaggaggacgagt
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A667HK09_BCL2L1-      -gccctgcggtg--------------------------------------
A0A667I624_BCL2L2-      cgccttgtggccttctttgtctttggagccgcactgtgtgctgagagtgt
A0A667I624_BCL2L2-      -gccctg-ggcc-----tggctcgggagcccc----cgggccagagg---

A0A667GHH0_BCL2-01      ----------------------------------------------gtcg
A0A667HQV5_BCL2A1-      ----------------------------------------------ggat
A0A667GW69_BCL2L10      ----------------------------------------------ggct
A0A667GXX5_MCL1-01      tgttccggcagtcgctggagattatctctcggtaccttcgggagcaggcg
A0A667GXX5_MCL1-02      ----------------------------------------------ggcg
A0A667HK09_BCL2L1-      ---------aat----------------------------------ggag
A0A667I624_BCL2L2-      caacaaggagat----------------------------------ggag
A0A667I624_BCL2L2-      -----aggagga----------------------------------ggag

A0A667GHH0_BCL2-01      cc--------------------------------------------cccg
A0A667HQV5_BCL2A1-      cc--------------------------------------------cacc
A0A667GW69_BCL2L10      ac------------------------------------------------
A0A667GXX5_MCL1-01      ac------------------------------------------------
A0A667GXX5_MCL1-02      ac------------------------------------------------
A0A667HK09_BCL2L1-      cc---------actggc-----------------------------caca
A0A667I624_BCL2L2-      ccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacg
A0A667I624_BCL2L2-      cc------gggactggt-cgagggtg-----------acccggggg-acg

A0A667GHH0_BCL2-01      c-----------------cgccgccgcgggccctgcgctcagccccgtgc
A0A667HQV5_BCL2A1-      c-----------------aagcagagtatcccaagtgctacaagacatgg
A0A667GW69_BCL2L10      ------------------c-gcggaaaccgcgtggaactggt-g------
A0A667GXX5_MCL1-01      ------------------cggcgccaaggacgcgaaaccactgg------
A0A667GXX5_MCL1-02      ------------------cggcgccaaggacgcgaaaccactgg------
A0A667HK09_BCL2L1-      gcag--------------cagcttggatgcccgggaggtgatccccatgg
A0A667I624_BCL2L2-      gctggccgactggattcacagcagtgggggctgggagctggaagcgatca
A0A667I624_BCL2L2-      g-----------------cgccattgaggacccggagctggaagcgatca
                                             *        *                   

A0A667GHH0_BCL2-01      cacctgtggtccacctg------------------------------acc
A0A667HQV5_BCL2A1-      ccttctcggtccagggg----------gaggtcgagaagaagttgaagcc
A0A667GW69_BCL2L10      --gcgcggttggagcaggatttactctccaacc---------cccaaacc
A0A667GXX5_MCL1-01      --gcgggtctggggcgg----------ccagccgaaaggcgttagagacc
A0A667GXX5_MCL1-02      --gcgggtctggggcgg----------ccagccgaaaggcgttagagacc
A0A667HK09_BCL2L1-      cagc---ggtgaagcag-gcgctgagggaggccggg------gatgagtt
A0A667I624_BCL2L2-      aagctcgagtcagggag-atggaggaagaagccgagaagctaaaggagct
A0A667I624_BCL2L2-      aagctcgagtcagggag-atggaggaagaagccgagaagctaaaggagct
                                 *      *                                 

A0A667GHH0_BCL2-01      ctgcgccaggccggc-----------gatgacttctcccgtcgctaccgc
A0A667HQV5_BCL2A1-      gtg--cctggacaagttccacgtggtgtcggtagacacggccagga-cga
A0A667GW69_BCL2L10      ctc-----agctggg-----------gccatgtggtagcgc--tct-tga
A0A667GXX5_MCL1-01      ctccgacgggtcggg-----------gacggcgtgcagcgcaacca-cga
A0A667GXX5_MCL1-02      ctccgacgggtcggg-----------gacggcgtgcagcgcaacca-cga
A0A667HK09_BCL2L1-      -tg-----aactgag-----------gt------accg-gcgggca-ttc
A0A667I624_BCL2L2-      aca-----gaacgag-----------gtagagaaacag-atgaata-tga
A0A667I624_BCL2L2-      aca-----gaacgag-----------gtagagaaacag-atgaata-tga

A0A667GHH0_BCL2-01      cgcgacttcgcggagatgtccagccagct-gcacctgacaccctttaccg
A0A667HQV5_BCL2A1-      tattcc---------------accaag------------tgatggaaaag
A0A667GW69_BCL2L10      -----cct-------------tcgcgg---ggacgc---tgctgga----
A0A667GXX5_MCL1-01      gaccgcct-------------tccaag---gcatgc---ttcggaaactg
A0A667GXX5_MCL1-02      gaccgcct-------------tccaag---gcatgc---ttcggaaactg
A0A667HK09_BCL2L1-      agcgacc---------tgacatcccagct-tcacatcaccccagggacag
A0A667I624_BCL2L2-      gtccacctccaggcaatgctggcccagtgatcatgt---ccattgaagag
A0A667I624_BCL2L2-      gtccacctccaggcaatgctggcccagtgatcatgt---ccattgaagag
                             *                    *                       

A0A667GHH0_BCL2-01      caaggggacgc----------------tttgccacggtggtggaggagct
A0A667HQV5_BCL2A1-      gagtttgaagacggcatc--------------------------------
A0A667GW69_BCL2L10      gagaccgccgccggggacctacttgaacct--------gacg-ccggccc
A0A667GXX5_MCL1-01      gacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg-atggtcc
A0A667GXX5_MCL1-02      gacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg-atggtcc
A0A667HK09_BCL2L1-      catatcagagc----------------tttgagcaggtagtgaatgaact
A0A667I624_BCL2L2-      aagatggaggctgatgccc--gttccatttatgttggcaatg--tggact
A0A667I624_BCL2L2-      aagatggaggctgatgccc--gttccatttatgttggcaatg--tggact

A0A667GHH0_BCL2-01      cttcagggatgg--agtgaactgggg-------------gaggattgtgg
A0A667HQV5_BCL2A1-      ---------------attaactgggg-------------caggattgtga
A0A667GW69_BCL2L10      a----gcaacaggagctggagtgggaggccaacgttggccaggactgcca
A0A667GXX5_MCL1-01      at---gttttcagtgacggagtaa-----caaactggggcaggattgtga
A0A667GXX5_MCL1-02      at---gttttcagtgacggagtaa-----caaactggggcaggattgtga
A0A667HK09_BCL2L1-      cttccgggatgg--ggtgaactggggtcgca-------------ttgtgg
A0A667I624_BCL2L2-      atggtgcaacagcagaagagctggaagcacacttt----catggctgtgg
A0A667I624_BCL2L2-      atggtgcaacagcagaagagctggaagcacacttt----catggctgtgg
                                             *                       **   

A0A667GHH0_BCL2-01      ---------ccttctttgagttcggtggggtcatgtgtgtggagagcgtc
A0A667HQV5_BCL2A1-      -----------ctatatttgcgtttgagggcatcct-------catcaag
A0A667GW69_BCL2L10      -------------------gcacctggtggc----tttgc----------
A0A667GXX5_MCL1-01      -----------ctcttatttcttttggtgcc----tttgtggcc------
A0A667GXX5_MCL1-02      -----------ctcttatttcttttggtgcc----tttgtggcc------
A0A667HK09_BCL2L1-      ---------cctttttctccttcggtggggcactgtgcgtgg-------a
A0A667I624_BCL2L2-      ttcagtcaaccgtgttaccatactttgtgacaaatttagtggccatccta
A0A667I624_BCL2L2-      ttcagtcaaccgtgttaccatactttgtgacaaatttagtggccatccta
                                                    *      *              

A0A667GHH0_BCL2-01      aaccg------------------------------------agagatgtc
A0A667HQV5_BCL2A1-      aagcttctccaggagcggatcgtcccagacgcggatgcgtttaaggtttc
A0A667GW69_BCL2L10      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------aaacacttgaagagtataaaccaa
A0A667GXX5_MCL1-02      --------------------------aaacacttgaagagtataaaccaa
A0A667HK09_BCL2L1-      aagcgt--------------------agacaaggag---atgcaggtatt
A0A667I624_BCL2L2-      aagggtttgcatatatagagt-tctcagacaaagagtcagtgaggacttc
A0A667I624_BCL2L2-      aagggtttgcatatatagagt-tctcagacaaagagtcagtgaggacttc

A0A667GHH0_BCL2-01      gcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggc
A0A667HQV5_BCL2A1-      ctactttgtcgccga-gtt----------------catcacgaaac----
A0A667GW69_BCL2L10      ----tctgcaatcgg-ctcac-------cggacggcatcgc---------
A0A667GXX5_MCL1-01      gaaagctgc-atcga-accat----tagcagaaagcatcac-agatgttc
A0A667GXX5_MCL1-02      gaaagctgc-atcga-accat----tagcagaaagcatcac-agatgttc
A0A667HK09_BCL2L1-      ggtg-----agtcgg-atcgcaacttggatggccacttacctgaacgacc
A0A667I624_BCL2L2-      cttggccttagatga-gtccctatttagaggaagacaaatcaaggtgatc
A0A667I624_BCL2L2-      cttggccttagatga-gtccctatttagaggaagacaaatcaaggtgatc

A0A667GHH0_BCL2-01      ---------acctgcacacgtggatccaagacaacggaggctggg---at
A0A667HQV5_BCL2A1-      ---------acacgggagaatggatccggcaaaacggaggctgggaaaac
A0A667GW69_BCL2L10      -----------------gcctggctggaggctcacgacggctggg---at
A0A667GXX5_MCL1-01      ttgtaaggacaaaacgagactggctagtcaaacaaagaggctggg---at
A0A667GXX5_MCL1-02      ttgtaaggacaaaacgagactggctagtcaaacaaagaggctggg---at
A0A667HK09_BCL2L1-      ---------acctagagccttggatccaggagaacggcggctggg---ac
A0A667I624_BCL2L2-      ccaaaacgaaccaacagaccaggcatcagcacaaca--gaccggg---g-
A0A667I624_BCL2L2-      ccaaaacgaaccaacagaccaggcatcagcacaaca--gaccggg---g-
                                             **          *    * * ***     

A0A667GHH0_BCL2-01      gcctttgtggaactgtacggccccagcatgcagcctctatt---------
A0A667HQV5_BCL2A1-      ggctttgtaaggaagttcgaacccaagtctg-------------------
A0A667GW69_BCL2L10      ggcttttgtctcttcttctc------------------------accca-
A0A667GXX5_MCL1-01      gggtttgtggagttcttccacgtagagg----------------acctag
A0A667GXX5_MCL1-02      gggtttgtggagttcttccacgtagagg----------------acctag
A0A667HK09_BCL2L1-      acttttgtggaactctacgggaacaatgcagcggccgag-----agccgg
A0A667I624_BCL2L2-      ---ttt-------cccacgagcccgataccgtgcccggaccaccaactac
A0A667I624_BCL2L2-      ---ttt-------cccacgagcccgataccgtgcccggaccaccaactac
                           ***           *                                

A0A667GHH0_BCL2-01      -----------------------------tgatttctcctggctgtccct
A0A667HQV5_BCL2A1-      -------------------------------------gctggctgacctt
A0A667GW69_BCL2L10      -----------------------------t----gctgccatct--tctt
A0A667GXX5_MCL1-01      aaggt-----------ggcatcagaaatgt----gctgctggct--t-tt
A0A667GXX5_MCL1-02      aaggt-----------ggcatcagaaatgt----gctgctggct--t-tt
A0A667HK09_BCL2L1-      aaggg---------------ccaggagcgcttcaaccgctggtt--cctg
A0A667I624_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggcc--ccgg
A0A667I624_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggcc--ccgg

A0A667GHH0_BCL2-01      gaaggcc-ctgctcagtctggccctggtgggggcttgcat------cacc
A0A667HQV5_BCL2A1-      tctggaagttacaggaa--------aga-----tctgcaa----------
A0A667GW69_BCL2L10      ggagaagactgctggtccaggctct--t-----ctgtcatgctttacagt
A0A667GXX5_MCL1-01      gcaggtg-ttgctggagtaggagctggt-----ttggcat----------
A0A667GXX5_MCL1-02      gcaggtg-ttgctggagtaggagctggt-----ttggcat----------
A0A667HK09_BCL2L1-      acaggcat-gactgtggctgg-cgtggt-----tctgc------------
A0A667I624_BCL2L2-      ggtcgcgtctacaggggccgg-gctaga-----gcgacat----------
A0A667I624_BCL2L2-      ggtcgcgtctacaggggccgg-gctaga-----gcgacat----------
                                   *                         *            

A0A667GHH0_BCL2-01      ctgggtgcctatctg-ggccacaagtga---------
A0A667HQV5_BCL2A1-      ggtgttgtctctcct------gaagaactactactga
A0A667GW69_BCL2L10      aatgaccttaatctacttctggagaagattattgtga
A0A667GXX5_MCL1-01      ----------atcta-------ataagatag------
A0A667GXX5_MCL1-02      ----------atcta-------ataagatag------
A0A667HK09_BCL2L1-      --tgggctcactcttcagtcggaaatga---------
A0A667I624_BCL2L2-      catggtattcccctt--------actaa---------
A0A667I624_BCL2L2-      catggtattcccctt--------actaa---------

© 1998-2021Legal notice