Dataset for CDS BCL2L2 of organism Cebus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5RUN8_BCL2L2-      ---------------------------------atggcggcggcggcggc
A0A2K5RUN8_BCL2L2-      ---------------------------------atggcggcggcggcggc
A0A2K5RUN8_BCL2L2-      ---------------------------------atggcgaccccagcctc
A0A2K5RUN8_BCL2L2-      catctttcatccttgcctcttatagccgcccggatggcgaccccagcctc
A0A2K5RUN8_BCL2L2-      ---------------------------------atggcgaccccagcctc
                                                         ****** *  * **  *

A0A2K5RUN8_BCL2L2-      ggcggcagcagcagcgggggctgcgggcggtc----ggggctccgggccg
A0A2K5RUN8_BCL2L2-      ggcggcagcagcagcgggggctgcgggcggtc----ggggctccgggccg
A0A2K5RUN8_BCL2L2-      ggccccagacaca-cgggctctggtggcagactttgtaggttataagctg
A0A2K5RUN8_BCL2L2-      ggccccagacaca-cgggctctggtggcagactttgtaggttataagctg
A0A2K5RUN8_BCL2L2-      ggccccagacaca-cgggctctggtggcagactttgtaggttataagctg
                        ***  ***   ** ****  ***  *** * *      ** *    ** *

A0A2K5RUN8_BCL2L2-      gggcggcggcgccatcttgtgcccggggccggt----ggggaggccgggg
A0A2K5RUN8_BCL2L2-      gggcggcggcgccatcttgtgcccggggccggt----ggggaggccgggg
A0A2K5RUN8_BCL2L2-      aggcagaagggtta---tgtctgtggagctggccccggggagggcccagc
A0A2K5RUN8_BCL2L2-      aggcagaagggtta---tgtctgtggagctggccccggggagggcccagc
A0A2K5RUN8_BCL2L2-      aggcagaagggtta---tgtctgtggagctggccccggggagggcccagc
                         *** *  * *  *   ***    ** ** **     ***  ****  * 

A0A2K5RUN8_BCL2L2-      agggggccc----------------cggggggc-gcaggggactacggga
A0A2K5RUN8_BCL2L2-      agggggccc----------------cggggggc-gcaggggactacggga
A0A2K5RUN8_BCL2L2-      agctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgaga
A0A2K5RUN8_BCL2L2-      agctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgaga
A0A2K5RUN8_BCL2L2-      agctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgaga
                        **  * ***                ****  ** * **  ** * ** **

A0A2K5RUN8_BCL2L2-      acggcctggag---------tctgaggaactggagcctgaggagctgctg
A0A2K5RUN8_BCL2L2-      acggcctggag---------tctgaggaactggagcctgagga-------
A0A2K5RUN8_BCL2L2-      cccgcttccggcgcaccttctctgat---ctggcggctcagctgcatgtg
A0A2K5RUN8_BCL2L2-      cccgcttccggcgcaccttctctgat---ctggcggctcagctgcatgtg
A0A2K5RUN8_BCL2L2-      cccgcttccggcgcaccttctctgat---ctggcggctcagctgcatgtg
                         * ** *   *         *****    **** * ** **         

A0A2K5RUN8_BCL2L2-      ctggagcccgagccggagcccgagcctgaagaggagccgccccggcccc-
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      -----------accccaggctcagcccaacaacgcttcacccaggtctcc
A0A2K5RUN8_BCL2L2-      -----------accccaggctcagcccaacaacgcttcacccaggtctcc
A0A2K5RUN8_BCL2L2-      -----------accccaggctcagcccaacaacgcttcacccaggtctcc
                                                                          

A0A2K5RUN8_BCL2L2-      -----gcgcccccccgggagctccg----------------ggccctggg
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      gatgaacttttccaagggggccccaactggggccgccttgtagccttctt
A0A2K5RUN8_BCL2L2-      gatgaacttttccaagggggccccaactggggccgccttgtagccttctt
A0A2K5RUN8_BCL2L2-      gatgaacttttccaagggggccccaactggggccgccttgtagccttctt
                                                                          

A0A2K5RUN8_BCL2L2-      cctggttcgggagcccccggcagtcaagag-------gaggaggaggagc
A0A2K5RUN8_BCL2L2-      -----------------------tcaagag-------gaggaggaggagc
A0A2K5RUN8_BCL2L2-      tgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaac
A0A2K5RUN8_BCL2L2-      tgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaac
A0A2K5RUN8_BCL2L2-      tgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaac
                                                  ****        *****  *** *

A0A2K5RUN8_BCL2L2-      c------gggac--------tggtcgagggtgac---ccgggggacggcg
A0A2K5RUN8_BCL2L2-      c------gggac--------tggtcgagggtgac---ccgggggacggcg
A0A2K5RUN8_BCL2L2-      cactggtgggacaagtgcaggagtggatggtggcctacctggagacgcgg
A0A2K5RUN8_BCL2L2-      cactggtgggacaagtgcaggagtggatggtggcctacctggagacgcgg
A0A2K5RUN8_BCL2L2-      cactggtgggacaagtgcaggagtggatggtggcctacctggagacgcgg
                        *      *****          ** ** **** *   ** ** ****  *

A0A2K5RUN8_BCL2L2-      c-------------------cattgaggacccggagctggaagctatcaa
A0A2K5RUN8_BCL2L2-      c-------------------cattgaggacccggagctggaagctatcaa
A0A2K5RUN8_BCL2L2-      ctggccgactggatccacagcagtgggggctgggagctggaagctatcaa
A0A2K5RUN8_BCL2L2-      ctggccgactggatccacagcagtgggggctgggcg------gagttcac
A0A2K5RUN8_BCL2L2-      ctggccgactggatccacagcagtgggggctgggcg------gagttcac
                        *                   ** ** ** *  ** *      *   *** 

A0A2K5RUN8_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagctaaaggaactac
A0A2K5RUN8_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagctaaaggaactac
A0A2K5RUN8_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagctaaaggaactac
A0A2K5RUN8_BCL2L2-      agctctatacgggg------------------------------------
A0A2K5RUN8_BCL2L2-      agctctatacgggg------------------------------------
                        ***** *  * ***                                    

A0A2K5RUN8_BCL2L2-      agaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5RUN8_BCL2L2-      agaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5RUN8_BCL2L2-      agaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5RUN8_BCL2L2-      ---acgggg-----------------------------------------
A0A2K5RUN8_BCL2L2-      ---acgggg-----------------------------------------
                           *** **                                         

A0A2K5RUN8_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5RUN8_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5RUN8_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5RUN8_BCL2L2-      ----------------ccctggaggaggcg-cggcgtctg----------
A0A2K5RUN8_BCL2L2-      ----------------ccctggaggaggcg-cggcgtctg----------
                                        ** * ******  *  ** * ***          

A0A2K5RUN8_BCL2L2-      catctatgttggcaatgtggactacggtgcaacagcagaagagctggaag
A0A2K5RUN8_BCL2L2-      catctatgttggcaatgtggactacggtgcaacagcagaagagctggaag
A0A2K5RUN8_BCL2L2-      catctatgttggcaatgtggactacggtgcaacagcagaagagctggaag
A0A2K5RUN8_BCL2L2-      --------------------------------cgggaggggaactgg---
A0A2K5RUN8_BCL2L2-      --------------------------------cgggaggggaactgg---
                                                        * * **  ** ****   

A0A2K5RUN8_BCL2L2-      ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5RUN8_BCL2L2-      ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5RUN8_BCL2L2-      ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5RUN8_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5RUN8_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5RUN8_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5RUN8_BCL2L2-      agagtcagtgaggacttccttggccttagacgagtccctatttagaggaa
A0A2K5RUN8_BCL2L2-      agagtcagtgaggacttccttggccttagacgagtccctatttagaggaa
A0A2K5RUN8_BCL2L2-      agagtcagtgaggacttccttggccttagacgagtccctatttagaggaa
A0A2K5RUN8_BCL2L2-      -gcatcagtgagga------------------------------------
A0A2K5RUN8_BCL2L2-      -gcatcagtgagga------------------------------------
                         *  **********                                    

A0A2K5RUN8_BCL2L2-      ggcaaatcaaggt-------------------------------------
A0A2K5RUN8_BCL2L2-      ggcaaatcaaggt-------------------------------------
A0A2K5RUN8_BCL2L2-      ggcaaatcaaggttgacgttaaggctttcatttattcatctctgactcag
A0A2K5RUN8_BCL2L2-      -------cagtgctgac---------------------------------
A0A2K5RUN8_BCL2L2-      -------cagtgctgac---------------------------------
                               **  *                                      

A0A2K5RUN8_BCL2L2-      --gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccgggg
A0A2K5RUN8_BCL2L2-      --gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccgggg
A0A2K5RUN8_BCL2L2-      gtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccgggg
A0A2K5RUN8_BCL2L2-      ---------------------------------------aggggccgtgg
A0A2K5RUN8_BCL2L2-      ---------------------------------------aggggccgtgg
                                                               *  * *** **

A0A2K5RUN8_BCL2L2-      ttttccacgagcccgctaccgggcacggaccaccaactacaacagttccc
A0A2K5RUN8_BCL2L2-      ttttccacgagcccgctaccgggcacggaccaccaactacaacagttccc
A0A2K5RUN8_BCL2L2-      ttttccacgagcccgctaccgggcacggaccaccaactacaacagttccc
A0A2K5RUN8_BCL2L2-      ----------------cactggg---------------------------
A0A2K5RUN8_BCL2L2-      ----------------cactggg---------------------------
                                         ** ***                           

A0A2K5RUN8_BCL2L2-      gctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
A0A2K5RUN8_BCL2L2-      gctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
A0A2K5RUN8_BCL2L2-      gctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
A0A2K5RUN8_BCL2L2-      ------------------------------ggccctg-----gtaactgt
A0A2K5RUN8_BCL2L2-      ------------------------------ggccctg-----gtaactgt
                                                      ***** *     *   **  

A0A2K5RUN8_BCL2L2-      aggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5RUN8_BCL2L2-      aggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5RUN8_BCL2L2-      aggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5RUN8_BCL2L2-      aggggcc--------------------ttttttgctagcaagtga
A0A2K5RUN8_BCL2L2-      aggggcc--------------------ttttttgctagcaagtga
                        *******                    * **   **  *   * *

© 1998-2021Legal notice