Dataset for CDS BAX-like of Organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A076FVB8_BAX-01       atggacg-ggtccggggagcaacccag--------aggcggg--------
A0A452EUN4_BAK1-01      atg-----gcttcgggacaaggtccaggtccccccaggcagggctgc-ga
A0A452G7C4_BOK-01       atggaggtgctgcggcgc---tcctcggtcctcgccgccgagatcatgga
                        ***     * * ***        *  *         * *  *        

A0A076FVB8_BAX-01       -gggcccaccagctct------------gagcagatcatgaaga-----c
A0A452EUN4_BAK1-01      tgagcctgacccctcttccgcatcggaggagcaggtagcccgggataccg
A0A452G7C4_BOK-01       cgcctttgaccgctcgcccaccgacaaggagctggtggcccagg---cca
                         *       *  ***             **** * *      *       

A0A076FVB8_BAX-01       aggggcccttttgcttcagggtttcat--------------------cca
A0A452EUN4_BAK1-01      aggaggtcttccgc-----agctacgt----------ctttta----ccg
A0A452G7C4_BOK-01       aggcgctcggccgc-----gagttcgtgcacgcgcggctgctacgcgctg
                        *** *  *    **        * * *                    *  

A0A076FVB8_BAX-01       ggatc-----gagcagggcgaatggggggagagacac-------------
A0A452EUN4_BAK1-01      ccatcagcaggagca-ggaggccgagggggcag---ctgctcctactgac
A0A452G7C4_BOK-01       gcctctcctggagc---gcgcccgagcgcgccgcgccggtccccggcggc
                           **     ****   * *   * * *    *   *             

A0A076FVB8_BAX-01       -------ccgagctgggcttggagcaggtgc-------------------
A0A452EUN4_BAK1-01      c------cagagatggtcaccttgc-------------------------
A0A452G7C4_BOK-01       cgcctggcggaggtgtgcgccgtgctgctgcgcctggcggacgagctgga
                               * *** **  *     **                         

A0A076FVB8_BAX-01       ----------cccaggatgcatc--caccaagaagc---tgagcgagtgt
A0A452EUN4_BAK1-01      ---------acccagagcctaccagcaccatggggcaggtgggccgccag
A0A452G7C4_BOK-01       gctgatccggcccagcgtctaccgcaac----------gtggcccgccag
                                  *****     * *   **           **  *      

A0A076FVB8_BAX-01       ctgaagcgc--------attggagatgaattggacag------taacatg
A0A452EUN4_BAK1-01      ctcgccgtc--------atcggggatgacatcaaccggcgctacgacacg
A0A452G7C4_BOK-01       ctgaacctctccttgcagtcggagaccgtggtgaccgacgcc--------
                        **      *         * ** **        ** *             

A0A076FVB8_BAX-01       gagctgcagaggatgatc--------gcagccgtggacacagactctccc
A0A452EUN4_BAK1-01      gagttccaggccatgctgcagcacctgcagccgacg--gcagacaacgcc
A0A452G7C4_BOK-01       ---ttcctggctgtg-----------gcgacc-------cagatcttctc
                            * * *    **           **  **       ****      *

A0A076FVB8_BAX-01       cgagaggtcttttt----ccgagtggcggctgaaatgttttccgacggca
A0A452EUN4_BAK1-01      tacgagtacttcac----caagatcgcgtccagcctgtttgagagcggca
A0A452G7C4_BOK-01       tgcaggcatcacatggggcaaggttgtgtc-------tctgtactcggt-
                             *            *    * * * *       * *     ***  

A0A076FVB8_BAX-01       acttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
A0A452EUN4_BAK1-01      ---tcaactggggccgcgtggtggctctgctgggcttcggctac------
A0A452G7C4_BOK-01       -----------ggccgcggg--------gctggccgtggactgt------
                                   ***** *            *   * * * *         

A0A076FVB8_BAX-01       gtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcat
A0A452EUN4_BAK1-01      ---cgcctggccctccacgtctaccagcgcggcctgaccgg---cttcct
A0A452G7C4_BOK-01       gtgcggcaggcccagcccgccctggtgcacgccctcgtcga---ctgtct
                           *    *****    *  *     ** **   *   *     *    *

A0A076FVB8_BAX-01       gggctggacattggacttccttcgagagcggctgctgggctggatccagg
A0A452EUN4_BAK1-01      gggccaggtgacccgcttcgtg--------gccgacttcat-gctgcgtc
A0A452G7C4_BOK-01       cggggag---------tttgtgcggaagacgctggcaacctggctgcgga
                         **   *         **  *         ** *      * * * *   

A0A076FVB8_BAX-01       a-------ccagggtggttgggacggcc----------------tcctct
A0A452EUN4_BAK1-01      gctccatcgcccggtggatcgcgcagagggg--tggctgggtgg-cagcc
A0A452G7C4_BOK-01       g-------gcgtggtggat-ggacagatgtgctcaagtgtgtggtcagca
                                 *  ***** * *  * *                   *  * 

A0A076FVB8_BAX-01       cctactttgggacacccacatggc-agacggtgaccatctttgtggctgg
A0A452EUN4_BAK1-01      ctggacttggggaacgcccccatcaagaacgtagccatagttctggctgt
A0A452G7C4_BOK-01       ccgacccaggcctgcgctctca-ctggctggtggccgcgct-----ctgc
                        *       **    * * *    *  *   **  **    *     *** 

A0A076FVB8_BAX-01       agtgct----caccgcctcg-----------ctcaccatctggaagaaga
A0A452EUN4_BAK1-01      ggttttgttgggccagtttgtggtacgaagattcttca------------
A0A452G7C4_BOK-01       agcttt----ggccgcttcctgaaggctgccttcttcatgctgttgccgg
                         *   *      **   *              **  **            

A0A076FVB8_BAX-01       tgggctga
A0A452EUN4_BAK1-01      agtcatga
A0A452G7C4_BOK-01       agagatga
                         *   ***

© 1998-2020Legal notice