Dataset for CDS BAX-like of organism Capra hircus

[Download (right click)] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8C2NFL1_BOK-01       atgtgtggcccttg----t-------gagctgctccacgtgagccccc--
A0A452G7C4_BOK-01       atgga----ggtgc----t-------gcggcgctcctcggtcctcgcc--
A0A452EUN4_BAK1-01      atggc----ttcgg------------gacaaggtccaggtcc-cccca--
A0A8C2S9F2_BAK1-02      atggc----ttcgg------------gacaaggtccaggtcc-cccca--
A0A8C2S9F2_BAK1-01      atggc----ttcgg------------gacaaggtccaggtcc-cccca--
A0A8C2RA97_BAX-05       atgag----acc--------------------------ccat-tctga--
A0A076FVB8_BAX-01       atgga----cgg--------------gtccggg--gagcaac-ccaga--
A0A8C2RA97_BAX-02       atgga----cgg--------------gtccggg--gagcaac-ccaga--
A0A8C2RA97_BAX-04       atgaa----gacaggggcccttttgcttcaggg--gtgnnnn-nnnnnnn
A0A8C2RA97_BAX-03       atgga----cgg--------------gtccggg--gagcaac-ccaga--
A0A8C2RA97_BAX-01       atgga----cgg--------------gtccggg--gagcaac-ccaga--
                        ***                                               

A0A8C2NFL1_BOK-01       --------------------------------------------------
A0A452G7C4_BOK-01       --------------------------------------------------
A0A452EUN4_BAK1-01      --------------------------------------------------
A0A8C2S9F2_BAK1-02      --------------------------------------------------
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       --------------------------------------------------
A0A076FVB8_BAX-01       --------------------------------------------------
A0A8C2RA97_BAX-02       --------------------------------------------------
A0A8C2RA97_BAX-04       nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       --------------------------------------------------
                                                                          

A0A8C2NFL1_BOK-01       ---------cccgcccccaccgcctcttgtcacggcctggagccgtccct
A0A452G7C4_BOK-01       ---------gccgagatcatggacgcctttgaccgctcgcc--------c
A0A452EUN4_BAK1-01      ---------ggc-agggctgcgatgagcctgacccctcttc--------c
A0A8C2S9F2_BAK1-02      ---------ggc-agggttgcgatgagcctgacccctcttc--------c
A0A8C2S9F2_BAK1-01      ---------ggc-agggttgcgatgagcctgacccctcttc--------c
A0A8C2RA97_BAX-05       ---------ttc-tgcat--------------------------------
A0A076FVB8_BAX-01       ---------ggc-ggggggcccaccagctctga-----------------
A0A8C2RA97_BAX-02       ---------ggc-ggggg--------------------------------
A0A8C2RA97_BAX-04       nnnnnnnnnnnn-nnnnnnnnnnnnnnnnnnnn-----------------
A0A8C2RA97_BAX-03       ---------ggc-ggggggcccaccagctctga-----------------
A0A8C2RA97_BAX-01       ---------ggc-ggggggcccaccagctctga-----------------
                                                                          

A0A8C2NFL1_BOK-01       tgcccccagcacctccagccccacccc---gca-cagatgccccgctctg
A0A452G7C4_BOK-01       accgacaaggagctggtggcccaggcc---aag-gcgc---t--------
A0A452EUN4_BAK1-01      gcatcggaggagcaggtagcccgggataccgag-gagg---t--------
A0A8C2S9F2_BAK1-02      gcatcggaggagcaggtagcccgggataccgag-gagg---t--------
A0A8C2S9F2_BAK1-01      gcatcggaggagcaggtagcccgggataccgag-gagg---t--------
A0A8C2RA97_BAX-05       ----------------------------ccccgcaact---c--------
A0A076FVB8_BAX-01       ------gcagatcat----------gaagacag-gggc---c--------
A0A8C2RA97_BAX-02       -------------------------tgagacag-gggc---c--------
A0A8C2RA97_BAX-04       ------nnnnnncat----------gaagacag-gggc---c--------
A0A8C2RA97_BAX-03       ------gcagatcat----------gaagacag-gggc---c--------
A0A8C2RA97_BAX-01       ------gcagatcat----------gaagacag-gggc---c--------
                                                                          

A0A8C2NFL1_BOK-01       agagcagcagcaaacaggaannnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A452G7C4_BOK-01       --------------------------------------------------
A0A452EUN4_BAK1-01      --------------------------------------------------
A0A8C2S9F2_BAK1-02      --------------------------------------------------
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       --------------------------------------------------
A0A076FVB8_BAX-01       --------------------------------------------------
A0A8C2RA97_BAX-02       --------------------------------------------------
A0A8C2RA97_BAX-04       --------------------------------------------------
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       --------------------------------------------------
                                                                          

A0A8C2NFL1_BOK-01       nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A452G7C4_BOK-01       --------------------------------------------------
A0A452EUN4_BAK1-01      --------------------------------------------------
A0A8C2S9F2_BAK1-02      --------------------------------------------------
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       --------------------------------------------------
A0A076FVB8_BAX-01       --------------------------------------------------
A0A8C2RA97_BAX-02       --------------------------------------------------
A0A8C2RA97_BAX-04       --------------------------------------------------
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       --------------------------------------------------
                                                                          

A0A8C2NFL1_BOK-01       nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A452G7C4_BOK-01       -----------------------------cggccgcgagttcgtgcacgc
A0A452EUN4_BAK1-01      -----------------------------cttccgcagctacgtctttta
A0A8C2S9F2_BAK1-02      -----------------------------cttccgcagctacgtctttta
A0A8C2S9F2_BAK1-01      -----------------------------cttccgcagctacgtctttta
A0A8C2RA97_BAX-05       -----------------------------cgttcccactctagtttcatc
A0A076FVB8_BAX-01       -----------------------------cttttgcttcagggtttcatc
A0A8C2RA97_BAX-02       -----------------------------cttttgcttcagggtttcatc
A0A8C2RA97_BAX-04       -----------------------------cttttgcttcagggtttcatc
A0A8C2RA97_BAX-03       -----------------------------cttttgcttca----------
A0A8C2RA97_BAX-01       -----------------------------cttttgcttcagggtttcatc
                                                                          

A0A8C2NFL1_BOK-01       nnnnn--------------nnnnncgctctggcttcagatcttcctgaat
A0A452G7C4_BOK-01       gcggc--------------tgctacgcgctggcctc--------------
A0A452EUN4_BAK1-01      ccgccatcagcaggagcaggaggccgagggggcagctgctcctactgacc
A0A8C2S9F2_BAK1-02      ccgccatcagcaggagcaggaggccgagggggcagctgcgcctactgacc
A0A8C2S9F2_BAK1-01      ccgccatcagcaggagcaggaggccgagggggcagctgcgcctactgacc
A0A8C2RA97_BAX-05       caggatcgagcag---------ggcgaatgggg-ggagagacacccgagc
A0A076FVB8_BAX-01       caggatcgagcag---------ggcgaatgggg-ggagagacacccgagc
A0A8C2RA97_BAX-02       caggatcgagcag---------ggcgaatgggg-ggagagacacccgagc
A0A8C2RA97_BAX-04       caggatcgagcag---------ggcgaatgggg-ggagagacacccgagc
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       caggatcgagcag---------ggcgaatgggg-ggagagacacccgagc
                                                                          

A0A8C2NFL1_BOK-01       tggatggagtgcagctggctccagggctgacgcgtcgcccttatcaccgg
A0A452G7C4_BOK-01       ------------tcctggagcgcgcccgagcgcgccgcgccggtccccgg
A0A452EUN4_BAK1-01      cagagatggtcaccttg--------------------------cacccag
A0A8C2S9F2_BAK1-02      cagagatggtcaccttg--------------------------cacccag
A0A8C2S9F2_BAK1-01      cagagatggtcaccttg--------------------------cacccag
A0A8C2RA97_BAX-05       tgggcttggagcaggtg--------------------------ccccagg
A0A076FVB8_BAX-01       tgggcttggagcaggtg--------------------------ccccagg
A0A8C2RA97_BAX-02       tgggcttggagcaggtg--------------------------ccccagg
A0A8C2RA97_BAX-04       tgggcttggagcaggtg--------------------------ccccagg
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       tgggcttggagcaggtg--------------------------ccccagg
                                                                          

A0A8C2NFL1_BOK-01       g-acctccagt-gggaagcatttccctgtttgctttggctggagaggcgg
A0A452G7C4_BOK-01       cggccgcctgg-cggaggtg--------------------------tgcg
A0A452EUN4_BAK1-01      agcctaccagcaccatgggg--------------------------cagg
A0A8C2S9F2_BAK1-02      agcctaccagcaccatgggg--------------------------cagg
A0A8C2S9F2_BAK1-01      agcctaccagcaccatgggg--------------------------cagg
A0A8C2RA97_BAX-05       atgcatccaccaagaagctg--------------------------agcg
A0A076FVB8_BAX-01       atgcatccaccaagaagctg--------------------------agcg
A0A8C2RA97_BAX-02       atgcatccaccaagaagctg--------------------------agcg
A0A8C2RA97_BAX-04       atgcatccaccaagaagctg--------------------------agcg
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       atgcatccaccaagaagctg--------------------------agcg
                                                                          

A0A8C2NFL1_BOK-01       ccgggctggg------ggacacccacggacgagctggagctgatccggcc
A0A452G7C4_BOK-01       ccgtgctgct------gc-gcctggcggacgagctggagctgatccggcc
A0A452EUN4_BAK1-01      tgggccgccagctcgccg-tcatcggggatgacatcaa------ccggcg
A0A8C2S9F2_BAK1-02      tgggccgccagctcgccg-tcatcggggatgacatcaa------ccggcg
A0A8C2S9F2_BAK1-01      tgggccgccagctcgccg-tcatcggggatgacatcaa------ccggcg
A0A8C2RA97_BAX-05       agtgtctgaa------gc-gcattggagatgaattgga------cag---
A0A076FVB8_BAX-01       agtgtctgaa------gc-gcattggagatgaattgga------cag---
A0A8C2RA97_BAX-02       agtgtctgaa------gc-gcattggagatgaattgga------cag---
A0A8C2RA97_BAX-04       agtgtctgaa------gc-gcattggagatgaattgga------cag---
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       agtgtctgaa------gc-gcattggagatgaattgga------cag---
                                                                          

A0A8C2NFL1_BOK-01       cagcgtctaccgcaacgtggcccgccagctgaacctc--------tcc-t
A0A452G7C4_BOK-01       cagcgtctaccgcaacgtggcccgccagctgaacctc--------tcc-t
A0A452EUN4_BAK1-01      cta---------cgacacggagttccaggccatgctgcagcacctgcagc
A0A8C2S9F2_BAK1-02      cta---------cgacacggagttccaggccatgctgcagcacctgcagc
A0A8C2S9F2_BAK1-01      cta---------cgacacggagttccaggccatgctgcagcacctgcagc
A0A8C2RA97_BAX-05       ------------taacatggagctgcagaggatgatc--------gcagc
A0A076FVB8_BAX-01       ------------taacatggagctgcagaggatgatc--------gcagc
A0A8C2RA97_BAX-02       ------------taacatggagctgcagaggatgatc--------gcagc
A0A8C2RA97_BAX-04       ------------taacatggagctgcagaggatgatc--------gcagc
A0A8C2RA97_BAX-03       ---------------------------ggggatgatc--------gcagc
A0A8C2RA97_BAX-01       ------------taacatggagctgcagaggatgatc--------gcagc
                                                   *   *   *          *   

A0A8C2NFL1_BOK-01       tgcagtcggagaccgtggtgaccgacgccttcctggctgtggcgaccc--
A0A452G7C4_BOK-01       tgcagtcggagaccgtggtgaccgacgccttcctggctgtggcgaccc--
A0A452EUN4_BAK1-01      cgacg--gcagacaac-gcctacgagtacttcaccaagatcgcgtcca--
A0A8C2S9F2_BAK1-02      cgacg--gcagacaac-gcctacgagtacttcaccaagatcgcgtcca--
A0A8C2S9F2_BAK1-01      cgacg--gcagacaac-gcctacgagtacttcaccaagatcgcgtccagg
A0A8C2RA97_BAX-05       tgtggacacagactct-ccccgagaggtctttttccgagtggcggctg--
A0A076FVB8_BAX-01       cgtggacacagactct-ccccgagaggtctttttccgagtggcggctg--
A0A8C2RA97_BAX-02       tgtggacacagactct-ccccgagaggtctttttccgagtggcggctg--
A0A8C2RA97_BAX-04       tgtggacacagactct-ccccgagaggtctttttccgagtggcggctg--
A0A8C2RA97_BAX-03       tgtggacacagactct-ccccgagaggtctttttccgagtggcggctg--
A0A8C2RA97_BAX-01       tgtggacacagactct-ccccgagaggtctttttccgagtggcggctg--
                         *  *    ****          **   ***        * *** *    

A0A8C2NFL1_BOK-01       ------------------agatcttctctgcagg---catcacatggggc
A0A452G7C4_BOK-01       ------------------agatcttctctgcagg---catcacatggggc
A0A452EUN4_BAK1-01      ------------------gcctgttt---gagagcggcatcaactggggc
A0A8C2S9F2_BAK1-02      ------------------gcctgttt---gagagcggcatcaactggggc
A0A8C2S9F2_BAK1-01      ccagcagcagcgcccacagcctgttt---gagagcggcatcaactggggc
A0A8C2RA97_BAX-05       ------------------aaatgttttccgacggcaacttcaactggggc
A0A076FVB8_BAX-01       ------------------aaatgttttccgacggcaacttcaactggggc
A0A8C2RA97_BAX-02       ------------------aaatgttttccgacggcaacttcaactggggc
A0A8C2RA97_BAX-04       ------------------aaatgttttccgacggcaacttcaactggggc
A0A8C2RA97_BAX-03       ------------------aaatgttttccgacggcaacttcaactggggc
A0A8C2RA97_BAX-01       ------------------aaatgttttccgacggcaacttcaactggggc
                                             * **    *   *   * ***  ******

A0A8C2NFL1_BOK-01       aaggttgtgtctctgtactcggtggccgcggggctggccgtggactgtgt
A0A452G7C4_BOK-01       aaggttgtgtctctgtactcggtggccgcggggctggccgtggactgtgt
A0A452EUN4_BAK1-01      cgcgtggtggctctgctgggcttcggctaccgcctggccctccacgtcta
A0A8C2S9F2_BAK1-02      cgcgtggtggctctgctgggcttcggctaccgcctggccctccacgtcta
A0A8C2S9F2_BAK1-01      cgcgtggtggctctgctgggcttcggctaccgcctggccctccacgtcta
A0A8C2RA97_BAX-05       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
A0A076FVB8_BAX-01       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
A0A8C2RA97_BAX-02       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
A0A8C2RA97_BAX-04       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
A0A8C2RA97_BAX-03       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
A0A8C2RA97_BAX-01       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
                           ** **  * **        * * *      ****   *  *      

A0A8C2NFL1_BOK-01       gcggcaggcccagcccgccctggtgcacgccctcgtcgactgtctcgggg
A0A452G7C4_BOK-01       gcggcaggcccagcccgccctggtgcacgccctcgtcgactgtctcgggg
A0A452EUN4_BAK1-01      ccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccg
A0A8C2S9F2_BAK1-02      ccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccg
A0A8C2S9F2_BAK1-01      ccagcgcggcctg-------------------------------------
A0A8C2RA97_BAX-05       gtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattgg
A0A076FVB8_BAX-01       gtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattgg
A0A8C2RA97_BAX-02       gtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattgg
A0A8C2RA97_BAX-04       gtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattgg
A0A8C2RA97_BAX-03       gtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattgg
A0A8C2RA97_BAX-01       gtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattgg
                                    *                                     

A0A8C2NFL1_BOK-01       agtttgtgcggaagacgctg---gcaacctggctgcggaggcgtggtgga
A0A452G7C4_BOK-01       agtttgtgcggaagacgctg---gcaacctggctgcggaggcgtggtgga
A0A452EUN4_BAK1-01      acttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggc
A0A8C2S9F2_BAK1-02      acttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggc
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       acttccttcgagagcggctg---ctgggctggatccaggaccagggtggt
A0A076FVB8_BAX-01       acttccttcgagagcggctg---ctgggctggatccaggaccagggtggt
A0A8C2RA97_BAX-02       acttccttcgagagcggctg---ctgggctggatccaggaccagggtggt
A0A8C2RA97_BAX-04       acttccttcgagagcggctg---ctgggctggatccaggaccagggtggt
A0A8C2RA97_BAX-03       acttccttcgagagcggctg---ctgggctggatccaggaccagggtggt
A0A8C2RA97_BAX-01       acttccttcgagagcggctg---ctgggctggatccaggaccagggtggt
                                                                          

A0A8C2NFL1_BOK-01       tggacagatgtgct-----------------caagtgtgt--ggtcag--
A0A452G7C4_BOK-01       tggacagatgtgct-----------------caagtgtgt--ggtcag--
A0A452EUN4_BAK1-01      tgggtggcagccct-----------------g---gacttggggaacg--
A0A8C2S9F2_BAK1-02      tgggtggcagccct-----------------g---gacttggggaacg--
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       tgggtgagacctctaaccccaccccattcccctgctcctctggggccctt
A0A076FVB8_BAX-01       tgggacggcctcct-----------------ctcctactttgggacac--
A0A8C2RA97_BAX-02       tgggacggcctcct-----------------ctcctactttgggacac--
A0A8C2RA97_BAX-04       tgggacggcctcct-----------------ctcctactttgggacac--
A0A8C2RA97_BAX-03       tgggacggcctcct-----------------ctcctactttgggacac--
A0A8C2RA97_BAX-01       tgggacggcctcct-----------------ctcctactttgggacac--
                                                                          

A0A8C2NFL1_BOK-01       -----------------caccgac--------------------------
A0A452G7C4_BOK-01       -----------------caccgac--------------------------
A0A452EUN4_BAK1-01      -----------------cccccat--------------------------
A0A8C2S9F2_BAK1-02      -----------------cccccat--------------------------
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       gggccttcctgtgcccaccacaggagtgcccccttccccattttggggtc
A0A076FVB8_BAX-01       -----------------ccacatg--------------------------
A0A8C2RA97_BAX-02       -----------------ccacatg--------------------------
A0A8C2RA97_BAX-04       -----------------ccacatg--------------------------
A0A8C2RA97_BAX-03       -----------------ccacatg--------------------------
A0A8C2RA97_BAX-01       -----------------ccacatg--------------------------
                                                                          

A0A8C2NFL1_BOK-01       ----------------------ccag------------------------
A0A452G7C4_BOK-01       ----------------------ccag------------------------
A0A452EUN4_BAK1-01      ----------------------caag------------------------
A0A8C2S9F2_BAK1-02      ----------------------caag------------------------
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       atatgtctgatcaacccctgattcacagggtgcccaatgacctgtccatg
A0A076FVB8_BAX-01       ----------------------gcag------------------------
A0A8C2RA97_BAX-02       ----------------------gcag------------------------
A0A8C2RA97_BAX-04       ----------------------gcag------------------------
A0A8C2RA97_BAX-03       ----------------------gcag------------------------
A0A8C2RA97_BAX-01       ----------------------gcag------------------------
                                                                          

A0A8C2NFL1_BOK-01       --------------------------------------------------
A0A452G7C4_BOK-01       --------------------------------------------------
A0A452EUN4_BAK1-01      --------------------------------------------------
A0A8C2S9F2_BAK1-02      --------------------------------------------------
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       acccttgacctcctcatgacctctgacctcctagtgacccctgccatgat
A0A076FVB8_BAX-01       --------------------------------------------------
A0A8C2RA97_BAX-02       --------------------------------------------------
A0A8C2RA97_BAX-04       --------------------------------------------------
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       --------------------------------------------------
                                                                          

A0A8C2NFL1_BOK-01       --------------------------------------------------
A0A452G7C4_BOK-01       --------------------------------------------------
A0A452EUN4_BAK1-01      --------------------------------------------------
A0A8C2S9F2_BAK1-02      --------------------------------------------------
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       gcctcgctgccctccctggtgcctccctccaattcctctggaatccctca
A0A076FVB8_BAX-01       --------------------------------------------------
A0A8C2RA97_BAX-02       --------------------------------------------------
A0A8C2RA97_BAX-04       --------------------------------------------------
A0A8C2RA97_BAX-03       --------------------------------------------------
A0A8C2RA97_BAX-01       --------------------------------------------------
                                                                          

A0A8C2NFL1_BOK-01       -------------------------------------gcctgc--gctct
A0A452G7C4_BOK-01       -------------------------------------gcctgc--gctct
A0A452EUN4_BAK1-01      -------------------------------------aacgtagccatag
A0A8C2S9F2_BAK1-02      -------------------------------------aacgtagccatag
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       agttctatgataatcctttaactcccccactcataggcccttgccccttc
A0A076FVB8_BAX-01       -------------------------------------acggtgaccatct
A0A8C2RA97_BAX-02       -------------------------------------acggtgaccatct
A0A8C2RA97_BAX-04       -------------------------------------acggtgaccatct
A0A8C2RA97_BAX-03       -------------------------------------acggtgaccatct
A0A8C2RA97_BAX-01       -------------------------------------acggtgaccatct
                                                                          

A0A8C2NFL1_BOK-01       cactggctggtggccgcgctctgcagctttggccgcttcctgaaggctgc
A0A452G7C4_BOK-01       cactggctggtggccgcgctctgcagctttggccgcttcctgaaggctgc
A0A452EUN4_BAK1-01      ttctggctgt-------------------------ggttttgttgggcca
A0A8C2S9F2_BAK1-02      ttctggctgt-------------------------ggttttgttgggcca
A0A8C2S9F2_BAK1-01      --------------------------------------------------
A0A8C2RA97_BAX-05       ttgtgccctc---------------------------tgaaccctcacgt
A0A076FVB8_BAX-01       ttgtggctgg-------------------------agtgctcaccgcctc
A0A8C2RA97_BAX-02       ttgtggctgg-------------------------agtgctcaccgcctc
A0A8C2RA97_BAX-04       ttgtggctgg-------------------------agtgctcaccgcctc
A0A8C2RA97_BAX-03       ttgtggctgg-------------------------agtgctcaccgcctc
A0A8C2RA97_BAX-01       ttgtggctgg-------------------------agtgctcaccgcctc
                                                                          

A0A8C2NFL1_BOK-01       cttcttcatgct---gttgccggagagatga
A0A452G7C4_BOK-01       cttcttcatgct---gttgccggagagatga
A0A452EUN4_BAK1-01      gtttgtggtacgaagattcttcaagtcatga
A0A8C2S9F2_BAK1-02      gtttgtggtacgaagattcttcaagtcatga
A0A8C2S9F2_BAK1-01      ------------------------------a
A0A8C2RA97_BAX-05       gctggcccaggg---gctgccccttggctga
A0A076FVB8_BAX-01       gctcaccatctg---gaagaagatgggctga
A0A8C2RA97_BAX-02       gctcaccatctg---gaagaagatgggctga
A0A8C2RA97_BAX-04       gctcaccatctg---gaagaagatgggctga
A0A8C2RA97_BAX-03       gctcaccatctg---gaagaagatgggctga
A0A8C2RA97_BAX-01       gctcaccatctg---gaagaagatgggctga
                                                      *

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice