Dataset for CDS BCL2A1 of organism Delphinapterus leucas

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=1023 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcactacaagtgaacctgtagag
atgagagtctgccaggttttctatcacagttttactggcctcatgaaacgagttggcattctttggacccggacttggaa
ttttctttctgtgttaagagcacacgtggccagaagagtggtcttctgcccagtctggaagcttggccagaggaactggt
gttcttgtgtaatgagatcatctttcaaaagtaccagacggtttttcgtccttctcacccaaacgcaacgtttcctggca
gccattccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaagtacaggatag
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=720 residues).
atggcggcgacggccgtgagcagcgccaagcggagcctgcgggccgagctgaagcggcgtctgcgggcgctgagcgccga
ggagcggctgcgccagtcccgcctcttggcccagaaggtgtttacccatagtcaatatcaaaagtccaaaagaatctcca
tctttctgagcatgcaagatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatc
ccacggtaccagttccagagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaac
atcctggaatattcatcagcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcacta
caagtgaacctgtagagatgagagtctgccaggttttctatcacagttttactggcctcatgaaacgagttggcattctt
tggacccggacttggaattttctttctgtgttaagagcacacgtggccagaagagtggtcttctgcccagtctggaagct
tggccagaggaactggtgttcttgtgtaatgagatcatctttcaaaagtaccagacggtttttcgtccttctcacccaaa
cgcaacgtttcctggcagccattccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaagtacaggatag
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=942 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcactacaagtgaacctgtagag
atgagagtctgccaggctgacccagttgaaagttgtaacagctggaggaatctctgttcgtctactcagaccagaactgg
gctcccactcgtgagtagtgccaacaaatgtgtcacttcccatttccttaaaaagctcccaaactcgggcacagtttata
gtcttgcttcacttctgctggaggagttcactacggcagattcaagctggggaaattgctaa
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=813 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcactacaagtgaacctgtagag
atgagagtctgccaggtggaatcatccatttcatatccacccccaccccgccccacttactgccagccagaaaaatggga
acttaccccctga
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-05 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=915 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacagggggacttgatctcatcttcatgccgggtcttgggttt
gacaaacacggcaaccgtttggggcggggcaagggctactacgatgcctacctgaagcgctgtctgcagtcccaggatgt
gaggccctacaccctggccttggctttcaaagagcagatttgccttcaggtccccgtggatgaaaatgacatgaaggtag
atgaagtgctttacgaagactcctcagcatcttaa
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-06 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=717 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacagcacacaggctttctctagttgcggcgagcgggtga
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-07 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=528 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggaaaatggctttgtaaagaagtttgaacccaagtctggctggctgacttttctggaagtt
acaggaaagatctgtgaaatattatgtctcctgaagcagtactattga
© 1998-2020Legal notice