Dataset for CDS BCL2A1 of organism Delphinapterus leucas

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2Y9LKR0_BCL2A1-      atgaccgacagcgagtttggctatattcacatgctggcccaggactacct
A0A2Y9LKR0_BCL2A1-      at----ggcggcga------------------------------------
A0A2Y9LKR0_BCL2A1-      atgaccgacagcgagtttggctatattcacatgctggcccaggactacct
A0A2Y9LKR0_BCL2A1-      atgaccgacagcgagtttggctatattcacatgctggcccaggactacct
A0A2Y9LKR0_BCL2A1-      atgaccgacagcgagtttggctatattcacatgctggcccaggactacct
A0A2Y9LKR0_BCL2A1-      atgaccgacagcgagtttggctatattcacatgctggcccaggactacct
A0A2Y9LKR0_BCL2A1-      atgaccgacagcgagtttggctatattcacatgctggcccaggactacct
                        **    * * ****                                    

A0A2Y9LKR0_BCL2A1-      gaagtacgtcttgcagataccgcaacctggatctggtccaagcaaaacat
A0A2Y9LKR0_BCL2A1-      ----------------------cggccgtgagcagcgccaagcggagcct
A0A2Y9LKR0_BCL2A1-      gaagtacgtcttgcagataccgcaacctggatctggtccaagcaaaacat
A0A2Y9LKR0_BCL2A1-      gaagtacgtcttgcagataccgcaacctggatctggtccaagcaaaacat
A0A2Y9LKR0_BCL2A1-      gaagtacgtcttgcagataccgcaacctggatctggtccaagcaaaacat
A0A2Y9LKR0_BCL2A1-      gaagtacgtcttgcagataccgcaacctggatctggtccaagcaaaacat
A0A2Y9LKR0_BCL2A1-      gaagtacgtcttgcagataccgcaacctggatctggtccaagcaaaacat
                                              *  **  ** * *  ******  * * *

A0A2Y9LKR0_BCL2A1-      ccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaag
A0A2Y9LKR0_BCL2A1-      gcggg--------------------------------ccgagctgaagcg
A0A2Y9LKR0_BCL2A1-      ccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaag
A0A2Y9LKR0_BCL2A1-      ccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaag
A0A2Y9LKR0_BCL2A1-      ccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaag
A0A2Y9LKR0_BCL2A1-      ccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaag
A0A2Y9LKR0_BCL2A1-      ccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaag
                         * **                                *  ** ****  *

A0A2Y9LKR0_BCL2A1-      aatttgaaaccatgcttggacaatattgatgttgtgtccatagacaccgc
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      aatttgaaaccatgcttggacaatattgatgttgtgtccatagacaccgc
A0A2Y9LKR0_BCL2A1-      aatttgaaaccatgcttggacaatattgatgttgtgtccatagacaccgc
A0A2Y9LKR0_BCL2A1-      aatttgaaaccatgcttggacaatattgatgttgtgtccatagacaccgc
A0A2Y9LKR0_BCL2A1-      aatttgaaaccatgcttggacaatattgatgttgtgtccatagacaccgc
A0A2Y9LKR0_BCL2A1-      aatttgaaaccatgcttggacaatattgatgttgtgtccatagacaccgc

A0A2Y9LKR0_BCL2A1-      cagaacaatattcaaccaagtgatggaaagggaatttgaagatggcatcg
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      cagaacaatattcaaccaagtgatggaaagggaatttgaagatggcatcg
A0A2Y9LKR0_BCL2A1-      cagaacaatattcaaccaagtgatggaaagggaatttgaagatggcatcg
A0A2Y9LKR0_BCL2A1-      cagaacaatattcaaccaagtgatggaaagggaatttgaagatggcatcg
A0A2Y9LKR0_BCL2A1-      cagaacaatattcaaccaagtgatggaaagggaatttgaagatggcatcg
A0A2Y9LKR0_BCL2A1-      cagaacaatattcaaccaagtgatggaaagggaatttgaagatggcatcg

A0A2Y9LKR0_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatc
A0A2Y9LKR0_BCL2A1-      -----------------------------gcgtctgcgggcgct------
A0A2Y9LKR0_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatc
A0A2Y9LKR0_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatc
A0A2Y9LKR0_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatc
A0A2Y9LKR0_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatc
A0A2Y9LKR0_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatc
                                                     ** * **  ***  *      

A0A2Y9LKR0_BCL2A1-      aagaaacttctaggagggcgaattgccccagatgtggacacttacaagga
A0A2Y9LKR0_BCL2A1-      ---gagcgccgaggagcg---gctgcgccag-------------------
A0A2Y9LKR0_BCL2A1-      aagaaacttctaggagggcgaattgccccagatgtggacacttacaagga
A0A2Y9LKR0_BCL2A1-      aagaaacttctaggagggcgaattgccccagatgtggacacttacaagga
A0A2Y9LKR0_BCL2A1-      aagaaacttctaggagggcgaattgccccagatgtggacacttacaagga
A0A2Y9LKR0_BCL2A1-      aagaaacttctaggagggcgaattgccccagatgtggacacttacaagga
A0A2Y9LKR0_BCL2A1-      aagaaacttctaggagggcgaattgccccagatgtggacacttacaagga
                            * *  * ***** *     *** ****                   

A0A2Y9LKR0_BCL2A1-      gatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
A0A2Y9LKR0_BCL2A1-      ----tcccgcctcttggc-----------ccagaa---------------
A0A2Y9LKR0_BCL2A1-      gatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
A0A2Y9LKR0_BCL2A1-      gatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
A0A2Y9LKR0_BCL2A1-      gatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
A0A2Y9LKR0_BCL2A1-      gatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
A0A2Y9LKR0_BCL2A1-      gatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
                            ***  * *  * **           *** **               

A0A2Y9LKR0_BCL2A1-      taaggcagaatggaggctggg-----------------------------
A0A2Y9LKR0_BCL2A1-      -------------------ggtgtttacccatagtcaatatcaaaagtcc
A0A2Y9LKR0_BCL2A1-      taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtcc
A0A2Y9LKR0_BCL2A1-      taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtcc
A0A2Y9LKR0_BCL2A1-      taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtcc
A0A2Y9LKR0_BCL2A1-      taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtcc
A0A2Y9LKR0_BCL2A1-      taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtcc

A0A2Y9LKR0_BCL2A1-      ----------------------------aaaatggctttg----------
A0A2Y9LKR0_BCL2A1-      aaaagaatctccatctttctgagcatgcaagatgaaattgagacagaaga
A0A2Y9LKR0_BCL2A1-      aaaagaatctccatctttctgagcatgcaagatgaaattgagacagaaga
A0A2Y9LKR0_BCL2A1-      aaaagaatctccatctttctgagcatgcaagatgaaattgagacagaaga
A0A2Y9LKR0_BCL2A1-      aaaagaatctccatctttctgagcatgcaagatgaaattgagacagaaga
A0A2Y9LKR0_BCL2A1-      aaaagaatctccatctttctgagcatgcaagatgaaattgagacagaaga
A0A2Y9LKR0_BCL2A1-      aaaagaatctccatctttctgagcatgcaagatgaaattgagacagaaga
                                                    ** ***   ***          

A0A2Y9LKR0_BCL2A1-      ------taaagaagttt------gaacccaagtctggctg-------gct
A0A2Y9LKR0_BCL2A1-      gatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggt
A0A2Y9LKR0_BCL2A1-      gatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggt
A0A2Y9LKR0_BCL2A1-      gatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggt
A0A2Y9LKR0_BCL2A1-      gatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggt
A0A2Y9LKR0_BCL2A1-      gatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggt
A0A2Y9LKR0_BCL2A1-      gatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggt
                               ** **  ***       *  * **  ***  *        * *

A0A2Y9LKR0_BCL2A1-      gacttttctgga--agttac----------------------------ag
A0A2Y9LKR0_BCL2A1-      accagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A2Y9LKR0_BCL2A1-      accagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A2Y9LKR0_BCL2A1-      accagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A2Y9LKR0_BCL2A1-      accagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A2Y9LKR0_BCL2A1-      accagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A2Y9LKR0_BCL2A1-      accagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
                          *  ***  **  * * **                            **

A0A2Y9LKR0_BCL2A1-      gaaagatctg-----------------tgaaatatta-------------
A0A2Y9LKR0_BCL2A1-      gaaatctcttcacttcccaaaacatcctggaatattcatcagcccagtga
A0A2Y9LKR0_BCL2A1-      gaaatctcttcacttcccaaaacatcctggaatattcatcagcccagtga
A0A2Y9LKR0_BCL2A1-      gaaatctcttcacttcccaaaacatcctggaatattcatcagcccagtga
A0A2Y9LKR0_BCL2A1-      gaaatctcttcacttcccaaaacatcctggaatattcatcagcccagtga
A0A2Y9LKR0_BCL2A1-      gaaatctcttcacttcccaaaacatcctggaatattcatcagcccagtga
A0A2Y9LKR0_BCL2A1-      gaaatctcttcacttcccaaaacatcctggaatattcatcagcccagtga
                        ****  ***                  ** ******              

A0A2Y9LKR0_BCL2A1-      -----------------------tgtctcctga-----------------
A0A2Y9LKR0_BCL2A1-      ggtcgaggttcgggaggaggccttgtccacagg-----------ttctct
A0A2Y9LKR0_BCL2A1-      ggtcgaggttcgggaggaggccttgtccacagggggacttgatctcatct
A0A2Y9LKR0_BCL2A1-      ggtcgaggttcgggaggaggccttgtccacagg-----------ttctct
A0A2Y9LKR0_BCL2A1-      ggtcgaggttcgggaggaggccttgtccacagg-----------ttctct
A0A2Y9LKR0_BCL2A1-      ggtcgaggttcgggaggaggccttgtccacagg-----------ttctct
A0A2Y9LKR0_BCL2A1-      ggtcgaggttcgggaggaggccttgtccacag------------------
                                               ****  * *                  

A0A2Y9LKR0_BCL2A1-      -------agcagt------------actattga-----------------
A0A2Y9LKR0_BCL2A1-      gctttccagcact------------acaagtgaacctgtagagatgag--
A0A2Y9LKR0_BCL2A1-      tcatgccgggtcttgggtttgacaaacacggcaaccgtttggggcggggc
A0A2Y9LKR0_BCL2A1-      gctttccagcact------------acaagtgaacctgtagagatgag--
A0A2Y9LKR0_BCL2A1-      gctttccagcact------------acaagtgaacctgtagagatgag--
A0A2Y9LKR0_BCL2A1-      gctttccagcact------------acaagtgaacctgtagagatgag--
A0A2Y9LKR0_BCL2A1-      ------------c------------aca----------------------

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --agtctgccaggttttctatcacagttttactggcctcatgaaacgagt
A0A2Y9LKR0_BCL2A1-      aagggctactacgatgcctacc-----------------------tgaag
A0A2Y9LKR0_BCL2A1-      --agtctgccaggt------------------------------------
A0A2Y9LKR0_BCL2A1-      --agtctgccaggctgac---------------------------ccagt
A0A2Y9LKR0_BCL2A1-      --agtctgccaggttttctatcacagttttactggcctcatgaaacgagt
A0A2Y9LKR0_BCL2A1-      ---------caggctttct--------------------------ctagt

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      tggcattctttggacccggacttggaatttt----------ctttctgtg
A0A2Y9LKR0_BCL2A1-      cgctgtctgcagtcccaggatgtgaggccctacaccctggccttggcttt
A0A2Y9LKR0_BCL2A1-      ----------------------ggaatcatc----------catttcata
A0A2Y9LKR0_BCL2A1-      tgaaagttgtaacagctgga--ggaatctct----------gttcgtcta
A0A2Y9LKR0_BCL2A1-      tggcattctttggacccggacttggaatttt----------ctttctgtg
A0A2Y9LKR0_BCL2A1-      tg------------------------------------------------

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      ttaagagcacacgtggccagaagagtggtcttctgcccagtctggaagct
A0A2Y9LKR0_BCL2A1-      caaagagcagatttgccttcagg-----------tccccgtggatgaaaa
A0A2Y9LKR0_BCL2A1-      tccacccccaccccg-------------------ccccactt---actgc
A0A2Y9LKR0_BCL2A1-      ctcagaccagaactgggc----------------tcccactcgtgagtag
A0A2Y9LKR0_BCL2A1-      ttaagagcacacgtggccagaagagtggtcttctgcccagtctggaagct
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      tggccagaggaactggtgttcttgtgtaatgagatcatctttcaaaagta
A0A2Y9LKR0_BCL2A1-      tgacatga-aggtagatga-------------------------------
A0A2Y9LKR0_BCL2A1-      cagccagaaaaatggg----------------------------------
A0A2Y9LKR0_BCL2A1-      tgcc--aacaaatgtgtcacttcccatttccttaaaaagctcccaaactc
A0A2Y9LKR0_BCL2A1-      tggccagaggaactggtgttcttgtgtaatgagatcatctttcaaaagta
A0A2Y9LKR0_BCL2A1-      cggc-----gagcgggtga-------------------------------

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      ccagacggtttttcgtccttctcacccaaacgcaacgtttcctggcagcc
A0A2Y9LKR0_BCL2A1-      ----------------------------------agtgctttacgaagac
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      gggcacagtttatagtcttgct----------tcacttctgctggagg--
A0A2Y9LKR0_BCL2A1-      ccagacggtttttcgtccttctcacccaaacgcaacgtttcctggcagcc
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      attccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaag
A0A2Y9LKR0_BCL2A1-      tcctcagcatcttaa-----------------------------------
A0A2Y9LKR0_BCL2A1-      aacttaccccctga------------------------------------
A0A2Y9LKR0_BCL2A1-      agttcactacggcagattcaagctggggaaat------------------
A0A2Y9LKR0_BCL2A1-      attccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaag
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------

A0A2Y9LKR0_BCL2A1-      ----------
A0A2Y9LKR0_BCL2A1-      tacaggatag
A0A2Y9LKR0_BCL2A1-      ----------
A0A2Y9LKR0_BCL2A1-      ----------
A0A2Y9LKR0_BCL2A1-      ----tgctaa
A0A2Y9LKR0_BCL2A1-      tacaggatag
A0A2Y9LKR0_BCL2A1-      ----------

© 1998-2021Legal notice