Dataset for CDS BCL2L2 of organism Ursus maritimus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452UF16_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A452UF16_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
                        **************************************************

A0A452UF16_BCL2L2-      tgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctg
A0A452UF16_BCL2L2-      tgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctg
                        **************************************************

A0A452UF16_BCL2L2-      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
A0A452UF16_BCL2L2-      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
                        **************************************************

A0A452UF16_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatttggcagccca
A0A452UF16_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatttggcagccca
                        **************************************************

A0A452UF16_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
A0A452UF16_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
                        **************************************************

A0A452UF16_BCL2L2-      acgaactcttccaagggggccccaactggggccgcctggtggccttcttt
A0A452UF16_BCL2L2-      acgaactcttccaagggggccccaactggggccgcctggtggccttcttt
                        **************************************************

A0A452UF16_BCL2L2-      gtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggagcc
A0A452UF16_BCL2L2-      gtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggagcc
                        **************************************************

A0A452UF16_BCL2L2-      acttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
A0A452UF16_BCL2L2-      acttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
                        **************************************************

A0A452UF16_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaa
A0A452UF16_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaa
                        **************************************************

A0A452UF16_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
A0A452UF16_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
                        **************************************************

A0A452UF16_BCL2L2-      gaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctg
A0A452UF16_BCL2L2-      gaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctg
                        **************************************************

A0A452UF16_BCL2L2-      gcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttcc
A0A452UF16_BCL2L2-      gcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttcc
                        **************************************************

A0A452UF16_BCL2L2-      atctatgttggcaacgtggactatggtgcaacagcagaagagctggaagc
A0A452UF16_BCL2L2-      atctatgttggcaacgtggactatggtgcaacagcagaagagctggaagc
                        **************************************************

A0A452UF16_BCL2L2-      acactttcatggctgtggttcagtcaatcgtgttaccatactctgtgaca
A0A452UF16_BCL2L2-      acactttcatggctgtggttcagtcaatcgtgttaccatactctgtgaca
                        **************************************************

A0A452UF16_BCL2L2-      aatttagtggccatcctaaagggtttgcatatatagagttctcagataaa
A0A452UF16_BCL2L2-      aatttagtggccatcctaaagggtttgcatatatagagttctcagataaa
                        **************************************************

A0A452UF16_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
A0A452UF16_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
                        **************************************************

A0A452UF16_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A452UF16_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
                        **************************************************

A0A452UF16_BCL2L2-      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
A0A452UF16_BCL2L2-      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
                        **************************************************

A0A452UF16_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A452UF16_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
                        **************************************************

A0A452UF16_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A452UF16_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggt------ttctgt
                        **************************************       *   *

A0A452UF16_BCL2L2-      aa
A0A452UF16_BCL2L2-      ag
                        * 

© 1998-2020Legal notice