Dataset for CDS BCL2L2 of organism Ursus maritimus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A384DPS8_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A384DPS8_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A384DPS8_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt

A0A384DPS8_BCL2L2-      tgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctg
A0A384DPS8_BCL2L2-      tgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctg
A0A384DPS8_BCL2L2-      tgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctg

A0A384DPS8_BCL2L2-      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
A0A384DPS8_BCL2L2-      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
A0A384DPS8_BCL2L2-      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga

A0A384DPS8_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatttggcagccca
A0A384DPS8_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatttggcagccca
A0A384DPS8_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatttggcagccca

A0A384DPS8_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
A0A384DPS8_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
A0A384DPS8_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg

A0A384DPS8_BCL2L2-      acgaactcttccaagggggccccaactggggccgcctggtggccttcttt
A0A384DPS8_BCL2L2-      acgaactcttccaagggggccccaactggggccgcctggtggccttcttt
A0A384DPS8_BCL2L2-      acgaactcttccaagggggccccaactggggccgcctggtggccttcttt

A0A384DPS8_BCL2L2-      gtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggagcc
A0A384DPS8_BCL2L2-      gtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggagcc
A0A384DPS8_BCL2L2-      gtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggagcc

A0A384DPS8_BCL2L2-      acttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
A0A384DPS8_BCL2L2-      acttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
A0A384DPS8_BCL2L2-      acttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc

A0A384DPS8_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
A0A384DPS8_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaa
A0A384DPS8_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaa
                        ********************************* *      * * *** *

A0A384DPS8_BCL2L2-      gctctatacgggga---------------cggggccctggaggaggcgcg
A0A384DPS8_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
A0A384DPS8_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
                        **** *  * ****                * *   **  *****   * 

A0A384DPS8_BCL2L2-      g-------------------------------------------------
A0A384DPS8_BCL2L2-      gaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctg
A0A384DPS8_BCL2L2-      gaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctg

A0A384DPS8_BCL2L2-      ------------cgtctgcgggaggggaactg------------------
A0A384DPS8_BCL2L2-      gcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttcc
A0A384DPS8_BCL2L2-      gcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttcc
                                     ****   * ** * *  **                  

A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      atctatgttggcaacgtggactatggtgcaacagcagaagagctggaagc
A0A384DPS8_BCL2L2-      atctatgttggcaacgtggactatggtgcaacagcagaagagctggaagc

A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      acactttcatggctgtggttcagtcaatcgtgttaccatactctgtgaca
A0A384DPS8_BCL2L2-      acactttcatggctgtggttcagtcaatcgtgttaccatactctgtgaca

A0A384DPS8_BCL2L2-      --------ggcc--------------------------------------
A0A384DPS8_BCL2L2-      aatttagtggccatcctaaagggtttgcatatatagagttctcagataaa
A0A384DPS8_BCL2L2-      aatttagtggccatcctaaagggtttgcatatatagagttctcagataaa

A0A384DPS8_BCL2L2-      ---tcagtgaggac------------------------------------
A0A384DPS8_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
A0A384DPS8_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag

A0A384DPS8_BCL2L2-      ---------agtg-------------------------------------
A0A384DPS8_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A384DPS8_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa

A0A384DPS8_BCL2L2-      ctgacagggg------------------ccgtggc---------------
A0A384DPS8_BCL2L2-      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
A0A384DPS8_BCL2L2-      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
                        * *** ****                  ***** *               

A0A384DPS8_BCL2L2-      ----------------------------------actgggggccctg---
A0A384DPS8_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A384DPS8_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
                                                          ** *  ***** *   

A0A384DPS8_BCL2L2-      --gtaactgtaggggccttttttgctagcaagtga---------------
A0A384DPS8_BCL2L2-      tcgcgtctacaggggcc----gggctag--agcgacatcatggt------
A0A384DPS8_BCL2L2-      tcgcgtctacaggggcc----gggctag--agcgacatcatggtattccc
                          *   **  *******      *****  ** **               

A0A384DPS8_BCL2L2-      --------
A0A384DPS8_BCL2L2-      ttctgtag
A0A384DPS8_BCL2L2-      cttactaa

© 1998-2023Legal notice