Dataset for CDS BCL-2-like of organism Hippocampus comes

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3DUT7_BCL2L1-      atgt--------------------------ctcaaaatcg----------
A0A3Q3DUT7_BCL2L1-      atgt--------------------------ctcaaaatcg----------
A0A3Q3DUT7_BCL2L1-      atgt--------------------------ctcaaaatcg----------
A0A3Q2XQX2_BCL2-02      atgg--------------------------cgaacgagcgaaatcgcacc
A0A3Q2XQX2_BCL2-01      atgg--------------------------cgaacgagcgaaatcgcacc
A0A3Q2XZL8_MCL1-01      atgagtatggtgcagcccacaagccaagttctgaagccccaaggccgccc
A0A3Q2Y539_MCL1-01      atg---------------------------ccggagagtaaacgctttcc
                        ***                           *                   

A0A3Q3DUT7_BCL2L1-      -------------agaactggttttgttttacattaggtacaa----act
A0A3Q3DUT7_BCL2L1-      -------------agaactggttttgttttacattaggtacaa----act
A0A3Q3DUT7_BCL2L1-      -------------agaactggttttgttttacattaggtacaa----act
A0A3Q2XQX2_BCL2-02      attgtgg------agaattatatctgccataaact---------------
A0A3Q2XQX2_BCL2-01      attgtgg------agaattatatctgccataaact---------------
A0A3Q2XZL8_MCL1-01      catgcgc--ccacaaaa-tggagtcgcggaaggcttattgcaatgcaact
A0A3Q2Y539_MCL1-01      cctgtataacttcaaggttggactcgtggacgctttaatg---------t
                                     *    *      *        *               

A0A3Q3DUT7_BCL2L1-      ttcccagaaaaactacc-------------cgctcaaccacataggactc
A0A3Q3DUT7_BCL2L1-      ttcccagaaaaactacc-------------cgctcaaccacataggactc
A0A3Q3DUT7_BCL2L1-      ttcccagaaaaactacc-------------cgctcaaccacataggactc
A0A3Q2XQX2_BCL2-02      ---ctccaaacgcggctacg-----------------------------c
A0A3Q2XQX2_BCL2-01      ---ctccaaacgcggctacg-----------------------------c
A0A3Q2XZL8_MCL1-01      ctccccccgtcgccgccgcgtccacatcgccgccacagcttcatcgggcc
A0A3Q2Y539_MCL1-01      tgcctccaaaggctgtcg---------------------ttcaaggatcc
                           *        *                                    *

A0A3Q3DUT7_BCL2L1-      agacaggcattgaacaggactgatggcagggaggaagcc-----------
A0A3Q3DUT7_BCL2L1-      agacaggcattgaacaggactgatggcagggaggaagcc-----------
A0A3Q3DUT7_BCL2L1-      agacaggcattgaacaggactgatggcagggaggaagcc-----------
A0A3Q2XQX2_BCL2-02      gtgggggttcggtgc-----------cggggaggaggacg----------
A0A3Q2XQX2_BCL2-01      gtgggggttcggtgc-----------cgaggacgatgccgccgctgctaa
A0A3Q2XZL8_MCL1-01      gtggcgaccttgggcgccgttaactgcaacagcggggccgccaagccccg
A0A3Q2Y539_MCL1-01      atgg---cctcg--------cagctgcaggaggtggaacgtcg-------
                                   *              *           *           

A0A3Q3DUT7_BCL2L1-      --------------------tcaggcgaggaggagcagcgggtacagacg
A0A3Q3DUT7_BCL2L1-      --------------------tcaggcgaggaggagcagcgggtacagacg
A0A3Q3DUT7_BCL2L1-      --------------------tcaggcgaggaggagcagcgggtacagacg
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
A0A3Q2XQX2_BCL2-01      taacggcttattggttgcaccctc---------gccgactttggtgctcc
A0A3Q2XZL8_MCL1-01      acctagcgccttggaaattctctgcaagggcggactagccaccatgaacc
A0A3Q2Y539_MCL1-01      -------------------ttctg--------------------------

A0A3Q3DUT7_BCL2L1-      cctgccaatgggacgacc-----------aacggcaccagtcccccggcg
A0A3Q3DUT7_BCL2L1-      cctgccaatgggacgacc-----------aacggcaccagtcccccggcg
A0A3Q3DUT7_BCL2L1-      cctgccaatgggacgacc-----------aacggcaccagtcccccggcg
A0A3Q2XQX2_BCL2-02      ----------------------------------------------atcg
A0A3Q2XQX2_BCL2-01      ggtgccgcgaagccagctccgggcccga-gcgcgactgcgcccccaagcg
A0A3Q2XZL8_MCL1-01      accgcaacaacagcgacgacgacttcgatgtggaaagcagcgacgactca
A0A3Q2Y539_MCL1-01      ------ataacagcgac------------atggatgaaggcgcccagccg

A0A3Q3DUT7_BCL2L1-      tcgccg--ctacgagaggcggcgagcctg-------gacgcggtgaagga
A0A3Q3DUT7_BCL2L1-      tcgccg--ctacgagaggcggcgagcctg-------gacgcggtgaagga
A0A3Q3DUT7_BCL2L1-      tcgccg--ctacgagaggcggcgagcctg-------gacgcggtgaagga
A0A3Q2XQX2_BCL2-02      aagcca---------cggttccgacccgctc-----gccgatatccaccg
A0A3Q2XQX2_BCL2-01      aagcca---------cggttccgacccgctc-----gccgatatccaccg
A0A3Q2XZL8_MCL1-01      ccaccgagtacccccgactcccaggactcactagtcgccgacggccgcaa
A0A3Q2Y539_MCL1-01      ttgccg---------gagctccaaacccctcc---------cggcc---a
                           **                *    *                       

A0A3Q3DUT7_BCL2L1-      ggccctgcgggactcggccaatgag----tttgagttgcgctactcccac
A0A3Q3DUT7_BCL2L1-      ggccctgcgggactcggccaatgag----tttgagttgcgctactcccac
A0A3Q3DUT7_BCL2L1-      ggccctgcgggactcggccaatgag----tttgagttgcgctactcccac
A0A3Q2XQX2_BCL2-02      ggtcctgcgtgaggccggcgacgaa----ctcgagagactttaccagccg
A0A3Q2XQX2_BCL2-01      ggtcctgcgtgaggccggcgacgaa----ctcgagagactttaccagccg
A0A3Q2XZL8_MCL1-01      cgacgtggtggacgccga-gaccaagggcctcattagacgttttctcaca
A0A3Q2Y539_MCL1-01      aggcgtcttggacaccga-gacgagacgtctcatcggccgcttcctccgt
                         * * *    **  * *   *  *      *       *  *        

A0A3Q3DUT7_BCL2L1-      gccttcagcgacctg--gacaaacagctgcacattacaccggccactgcc
A0A3Q3DUT7_BCL2L1-      gccttcagcgacctg--gacaaacagctgcacattacaccggccactgcc
A0A3Q3DUT7_BCL2L1-      gccttcagcgacctg--gacaaacagctgcacattacaccggccactgcc
A0A3Q2XQX2_BCL2-02      gatttcaccgagatgtc--ccgacagctgtacc----------tctcgtc
A0A3Q2XQX2_BCL2-01      gatttcaccgagatgtc--ccgacagctgtacc----------tctcgtc
A0A3Q2XZL8_MCL1-01      gactttaccggcctgtcgactgctagctggaacgaaagcaaggcacattc
A0A3Q2Y539_MCL1-01      gactttaccgggctgtccactgctgcttggatccaaagcaaagcccagtc
                        *  ** * **   **    *       ** *                  *

A0A3Q3DUT7_BCL2L1-      tacca-----------------------------aagc-----------t
A0A3Q3DUT7_BCL2L1-      tacca-----------------------------aagc-----------t
A0A3Q3DUT7_BCL2L1-      tacca-----------------------------aagc-----------t
A0A3Q2XQX2_BCL2-02      cactac-----------------------------agctcagaggc-ggt
A0A3Q2XQX2_BCL2-01      cactac-----------------------------agctcagaggc-ggt
A0A3Q2XZL8_MCL1-01      gaccatgaaaagagtcgtggctaaggttttggaaaagcacaagtacaagt
A0A3Q2Y539_MCL1-01      gacaatgaagagggtcgtgacgagactggtggacaagcacaggatcttat
                         ** *                              ***           *

A0A3Q3DUT7_BCL2L1-      ttgagaacgttgtggatgaggtgttccaggacga----------------
A0A3Q3DUT7_BCL2L1-      ttgagaacgttgtggatgaggtgttccaggacga----------------
A0A3Q3DUT7_BCL2L1-      ttgagaacgttgtggatgaggtgttccaggacga----------------
A0A3Q2XQX2_BCL2-02      tcgccgaggtgatcgacgaactgttccgggacgg----------------
A0A3Q2XQX2_BCL2-01      tcgccgaggtgatcgacgaactgttccgggacgg----------------
A0A3Q2XZL8_MCL1-01      acaatggtatcatcaacaaattgtctctggacgaccgaggggacaacgtg
A0A3Q2Y539_MCL1-01      tcaataacatggtcaacgaactgtcactggaccaaagagggctcgacagg
                                 *  *  *  *  ***  * ****                  

A0A3Q3DUT7_BCL2L1-      --------------------------------------------cgtcaa
A0A3Q3DUT7_BCL2L1-      --------------------------------------------cgtcaa
A0A3Q3DUT7_BCL2L1-      --------------------------------------------cgtcaa
A0A3Q2XQX2_BCL2-02      --------------------------------------------cgtcaa
A0A3Q2XQX2_BCL2-01      --------------------------------------------cgtcaa
A0A3Q2XZL8_MCL1-01      agcttcatcagtgaagtagccaagagcctgttttcggatgggacaaccaa
A0A3Q2Y539_MCL1-01      tcctttgtcagccaggtggcccaaacggaattcgccaatgggaacattaa

A0A3Q3DUT7_BCL2L1-      ctggggccgcatcgtggggctcttcgcgttcggcggcgcgctgtgcgtcg
A0A3Q3DUT7_BCL2L1-      ctggggccgcatcgtggggctcttcgcgttcggcggcgcgctgtgcgtcg
A0A3Q3DUT7_BCL2L1-      ctggggccgcatcgtggggctcttcgcgttcggcggcgcgctgtgcgtcg
A0A3Q2XQX2_BCL2-02      ctggggccggatcatcgccttcttcgagttcggcggcaccgtgtgcgtgg
A0A3Q2XQX2_BCL2-01      ctggggccggatcatcgccttcttcgagttcggcggcaccgtgtgcgtgg
A0A3Q2XZL8_MCL1-01      ctgggggcgcgtggccagcttggtggcctttggggccattgtgtcc---c
A0A3Q2Y539_MCL1-01      ctggggtcgcatcgccagcctgttggccttctgtgccgtgctgtct---c
                        ****** **  *        *  * *  **  * * *    ***      

A0A3Q3DUT7_BCL2L1-      aatgcatg---gagaaggagatgatccccctggttgacaggatcatcgag
A0A3Q3DUT7_BCL2L1-      aatgcatg---gagaaggagatgatccccctggttgacaggatcatcgag
A0A3Q3DUT7_BCL2L1-      aatgcatg---gagaaggagatgatccccctggttgacaggatcatcgag
A0A3Q2XQX2_BCL2-02      agtgcgccactaaggaggacatgacgtcgcaagtggacaacatagccgag
A0A3Q2XQX2_BCL2-01      agtgcgccactaaggaggacatgacgtcgcaagtggacaacatagccgag
A0A3Q2XZL8_MCL1-01      agcacctgaaagaaaagggccgggcccactgtgtggagccggtggccgat
A0A3Q2Y539_MCL1-01      aagccttgaaagaaaatcagcaggagaggtgcgtggaactggtggcccag
                        *   *       *  *      *         ** **     *   * * 

A0A3Q3DUT7_BCL2L1-      tggatgacggtgtacctggacaaccaccttcagccctggatagagagcca
A0A3Q3DUT7_BCL2L1-      tggatgacggtgtacctggacaaccaccttcagccctggatagagagcca
A0A3Q3DUT7_BCL2L1-      tggatgacggtgtacctggacaaccaccttcagccctggatagagagcca
A0A3Q2XQX2_BCL2-02      tggatgactgagtacttaaacggacccctaggcagctggatccaagacaa
A0A3Q2XQX2_BCL2-01      tggatgactgagtacttaaacggacccctaggcagctggatccaagacaa
A0A3Q2XZL8_MCL1-01      gagatctcttcgtatctgctgtcgcaccagcgcaactggctggtgaaaaa
A0A3Q2Y539_MCL1-01      gaggtctcgacctacttgctgtcacaccagcgcacctggctagtgcagca
                          * *  *    **  *       * **       **** *        *

A0A3Q3DUT7_BCL2L1-      aggaggatggcaacgctttgccgaaatttttggccacgacgcggcagcgg
A0A3Q3DUT7_BCL2L1-      aggaggatggcaacgctttgccgaaatttttggccacgacgcggcagcgg
A0A3Q3DUT7_BCL2L1-      aggaggatggcaacgctttgccgaaatttttggccacgacgcggcagcgg
A0A3Q2XQX2_BCL2-02      cgggggctgggatgcttttgtggagctctacgaccgtcagagggactc--
A0A3Q2XQX2_BCL2-01      cgggggctgggatgcttttgtggagctctacgaccgtcagagggactc--
A0A3Q2XZL8_MCL1-01      caactcttgggatggctttgtacaattcttt--------cgggaagtg--
A0A3Q2Y539_MCL1-01      caacggttgggatggatttgcagaattcttc--------aaggaagac--
                               *** *    ****   *  * *             *       

A0A3Q3DUT7_BCL2L1-      aggtccgccgctccca-ggagagtttcaagaagtggcttttggccggggt
A0A3Q3DUT7_BCL2L1-      aggtccgccgctccca-ggagagtttcaagaagtggcttttggccggggt
A0A3Q3DUT7_BCL2L1-      aggtccgccgctccca-ggagagtttcaagaagtggcttttggccggggt
A0A3Q2XQX2_BCL2-02      -tgtcttcag-ctgcacgtggccgtccatcaagacagtcttcggcctggc
A0A3Q2XQX2_BCL2-01      -tgtcttcag-ctgcacgtggccgtccatcaagacagtcttcggcctggc
A0A3Q2XZL8_MCL1-01      -gatcctgagtctaca-gtg-------aggaacacattaatggcctttgc
A0A3Q2Y539_MCL1-01      -gacctggagtctaca-gtg-------aggaatggcctcttcgcctttgt
                            *    *    ** *         *  **     *  * * *   * 

A0A3Q3DUT7_BCL2L1-      -gaccttgg--tgaccggggtcgtggtgggctcgctcatcgcccagaagc
A0A3Q3DUT7_BCL2L1-      -gaccttgg--tgaccggggtcgtggtgggctcgctcatcgcccagaagc
A0A3Q3DUT7_BCL2L1-      -gaccttgg--tgaccggggtcgtggtgggctcgctcatcgcccagaagc
A0A3Q2XQX2_BCL2-02      cgcgctcggggcggccagcctcaccattggcgcgtacctcacccag----
A0A3Q2XQX2_BCL2-01      cgcgctcggggcggccagcctcaccattggcgcgtacctcacccag----
A0A3Q2XZL8_MCL1-01      ------tggagtggctggcat------tggcgccacactggccctgttga
A0A3Q2Y539_MCL1-01      ------tggtttggtcagcgtcactg-cagcgctacgctgtc-----tga
                               **   *    *  *        ** *     *  *        

A0A3Q3DUT7_BCL2L1-      gcctgtga
A0A3Q3DUT7_BCL2L1-      gcctgtga
A0A3Q3DUT7_BCL2L1-      gcctgtga
A0A3Q2XQX2_BCL2-02      --aagtga
A0A3Q2XQX2_BCL2-01      --aagtga
A0A3Q2XZL8_MCL1-01      tcaggtga
A0A3Q2Y539_MCL1-01      ttcgatga

© 1998-2020Legal notice