Dataset for CDS BOK of Organism Esox lucius

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3P8XLU6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Esox lucius GN=BOK (length=642 residues).
atggagatgctgcgtcgttcctcagtattcgcagcagaagtgatggaagtgtttgaccgttcccccacagacaaggagct
tgtatcacaggcaaaggcgctatgcagggactacatcaattccaggctgaatcgaacagggattgggtggtcgaaacagg
ataatatgttgtctgcatcgggcgggacgcttggagaggtgtcctctgtcctcctttggttaggcgatgagttggagtac
ctgcggcctaacatttaccgcaacgtagctcggcagctcaacatcaccgtggcatctgagagcgtggtgtcggacgcctt
cctggccgtggctgcagagatcttctccacgggtgtaacgtgggggaaggtggtgtccttgtatgcggtggcgggagccc
tggcggtggactgcgtgcgccatggttatcccgccatggtccacaccatcgtagactgcatgggggagtttgtccgcaag
agcctggtctcctggctgaagaggagagggggctgggtggatattacaaagtgcgtggtaaacacggacccaagcttccg
ctcccattggttggtttctgcagcgtgcacctgtggacattacctgaaggccgttgtgttttacctgcttcgggacaagt
ga
>gnl|bcl2dbcds|A0A3P8Z3P5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Esox lucius GN=BOK (length=627 residues).
atggaggtgattcgtcgctcctctgtgtttgcagctggggtgatggaggcctttgactattccccgtcggacaaagagct
ggtgttccaggccaaggccttgtgcagggactacatccactccagactcaacctctacggactgggctcgtccaaaaccc
aggtggactcgacgccttgtgaggtgtccgctgtgcttctctgtctcggtgacgagctggagtgcatgcgaccaagtgtt
taccgcaatgtggcgaagcagctcaacatctcagtggccatggagaccacagtgtccgatgccttcgtcgctgtggcaac
ggagatattctctgcaggaatcacttgggggaaggtggtatccatgtatgcggtggctggtgctctagcagtggactgtg
tgcgtcagaaccagcctgctacggtccagaccatcgtggacagcctgggtcacttcgtacgtaagaacctggcccattgg
ctgaagaaacgtggaggatgggcggacattaagaactgtgttgtcaaagtagatgccgtttctcagacccattggctgtc
tcctgttgcggagtcctgcaagcactttttgtcaacactttatatttacattatgaaggagtcatga
© 1998-2023Legal notice