Dataset for CDS BOK of Organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8XLU6_BOK-01      atggagatgctgcgtcgttcctcagtattcgcagcagaagtgatggaagt
A0A3P8Z3P5_BOK-01      atggaggtgattcgtcgctcctctgtgtttgcagctggggtgatggaggc
                       ****** ** * ***** ***** ** ** ***** *  ******** * 

A0A3P8XLU6_BOK-01      gtttgaccgttcccccacagacaaggagcttgtatcacaggcaaaggcgc
A0A3P8Z3P5_BOK-01      ctttgactattccccgtcggacaaagagctggtgttccaggccaaggcct
                        ******  ******  * ***** ***** ** *  ***** *****  

A0A3P8XLU6_BOK-01      tatgcagggactacatcaattccaggctgaatcgaacagggattgggtgg
A0A3P8Z3P5_BOK-01      tgtgcagggactacatccactccagactcaacctctacggactgggctcg
                       * *************** * ***** ** ** *     **  * ** * *

A0A3P8XLU6_BOK-01      tcgaaa---caggataatatgttgtctgcatcgggcgggacgcttggaga
A0A3P8Z3P5_BOK-01      tccaaaacccagg------------------tggactcgacgccttgtga
                       ** ***   ****                   ** *  ***** * * **

A0A3P8XLU6_BOK-01      ggtgtcctctgtcctcctttggttaggcgatgagttggagtacctgcggc
A0A3P8Z3P5_BOK-01      ggtgtccgctgtgcttctctgtctcggtgacgagctggagtgcatgcgac
                       ******* **** ** ** **  * ** ** *** ****** * **** *

A0A3P8XLU6_BOK-01      ctaacatttaccgcaacgtagctcggcagctcaacatcaccgtggcatct
A0A3P8Z3P5_BOK-01      caagtgtttaccgcaatgtggcgaagcagctcaacatctcagtggccatg
                       * *   ********** ** **   ************* * *****    

A0A3P8XLU6_BOK-01      gagagcgtggtgtcggacgccttcctggccgtggctgcagagatcttctc
A0A3P8Z3P5_BOK-01      gagaccacagtgtccgatgccttcgtcgctgtggcaacggagatattctc
                       **** *   ***** ** ****** * ** *****  * ***** *****

A0A3P8XLU6_BOK-01      cacgggtgtaacgtgggggaaggtggtgtccttgtatgcggtggcgggag
A0A3P8Z3P5_BOK-01      tgcaggaatcacttgggggaaggtggtatccatgtatgcggtggctggtg
                         * **  * ** ************** *** ************* ** *

A0A3P8XLU6_BOK-01      ccctggcggtggactgcgtgcgccatggttatcccgccatggtccacacc
A0A3P8Z3P5_BOK-01      ctctagcagtggactgtgtgcgtcagaaccagcctgctacggtccagacc
                       * ** ** ******** ***** **     * ** ** * ****** ***

A0A3P8XLU6_BOK-01      atcgtagactgcatgggggagtttgtccgcaagagcctggtctcctggct
A0A3P8Z3P5_BOK-01      atcgtggacagcctgggtcacttcgtacgtaagaacctggcccattggct
                       ***** *** ** ****  * ** ** ** **** ***** *   *****

A0A3P8XLU6_BOK-01      gaagaggagagggggctgggtggatattacaaagtgcgtggtaaacacgg
A0A3P8Z3P5_BOK-01      gaagaaacgtggaggatgggcggacattaagaactgtgttgtcaaagtag
                       *****   * ** ** **** *** ****  ** ** ** ** **    *

A0A3P8XLU6_BOK-01      acccaagcttccgctcccattggttggtttctgcagcgtgcacctgtgga
A0A3P8Z3P5_BOK-01      atgccgtttctcagacccattggctgtctcctgttgcggagtcctgcaag
                       *  *    *  *   ******** **  * ***  ***    ****    

A0A3P8XLU6_BOK-01      cattacctgaaggccgttgtgttttacctgcttcgggacaagtga
A0A3P8Z3P5_BOK-01      cactttttgtcaacactttatatttacattatgaaggagtcatga
                       ** *   **    *  **    ***** *  *   ***    ***

© 1998-2023Legal notice