Dataset for CDS MCL-1 of organism Oreochromis niloticus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|I3JHR5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=885 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacgacccgggaggtggaatggacaaaaggaaaaatgtttcaaattacattatttaa
ttcacagagatctatttttgctaaaagatgccataataaaaaggaaaaagacattttttttccttttttgctagtctttt
tttaa
>gnl|bcl2dbcds|I3JHR5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=837 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|I3JHR5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=972 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggacaaacactcactcaggtctcaggaagaaatggagagtgtctcgccatggtgatgatccacagc
aggcctcccctaatcttctcctgtggctaatgttatctaccacccaggttacccctgtagttaactgtgaagaacacact
ggtagacaatag
>gnl|bcl2dbcds|I3KXG5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=684 residues).
atgttctccttaaattgctgtctgtctgagtggtgtccaaacaacgatgtgggctttatagataattgggaaaccctctg
taggaaacctggtcttgttaggagagacggcatccatcccactttggatggagcagctctcatttctagaaatctggaag
acggttcgttgccgagcaccccggaagaaactaaactcattattcacagttttttgggagactttactggactttctcag
cctcaacgaaaggaaaccaaagcactaaaaatgatgaaaagagttgttgcggacgtattagaaaagcacagatatgctta
caacggaatgattaataaattgtcattggatgaaagagaagaagatatgtcatttgtagcgaagagcctctttggagacc
acacgaccaactggggtcgtattgtcagctttgtggccttcggggcagtggtgtctcagcacctgaaggaaaagggcagg
gacaactgcgtggtgctagtgagtcaagagatttctgcatacttgctgtctgaacagcgagactggattatcaaaaacaa
tgcatgggatggctttgtggcgttcgttcgagtagcagaccctgagtcgatagtcaggaacacactcatggcctttgctg
gatttgcttgtattggggcaacactggcactgttgatcaggtga
© 1998-2020Legal notice