Dataset for CDS MCL-1 of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3KXG5_MCL1-01      ---------------atgtt------------------ctccttaaattgctgtctgtct
I3JHR5_MCL1-03      atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcct
I3JHR5_MCL1-02      atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcct
I3JHR5_MCL1-01      atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcct
                                   ****                   ** * ** * *    ***  **

I3KXG5_MCL1-01      --gagtggtgtcc---aaacaacgatgtgggctttatagataattgggaaaccctct--g
I3JHR5_MCL1-03      caaaatggagtcctggagggaccaat----gcactatggat--cggggaaatcctctccg
I3JHR5_MCL1-02      caaaatggagtcctggagggaccaat----gcactatggat--cggggaaatcctctccg
I3JHR5_MCL1-01      caaaatggagtcctggagggaccaat----gcactatggat--cggggaaatcctctccg
                       * *** ****   *   * * **    **  *** ***    ****** *****  *

I3KXG5_MCL1-01      taggaaacc---tggtcttgttagg-----agagacggcatc-----------catccca
I3JHR5_MCL1-03      cagaatgccacaggctcctctaaagactctagcaacgggattgtgtctaatggtaccccc
I3JHR5_MCL1-02      cagaatgccacaggctcctctaaagactctagcaacgggattgtgtctaatggtaccccc
I3JHR5_MCL1-01      cagaatgccacaggctcctctaaagactctagcaacgggattgtgtctaatggtaccccc
                     ** *  **    * ** * * * *     **  **** **             * *** 

I3KXG5_MCL1-01      ctttggatggagcagctc----tcatttcta----------------gaaatct------
I3JHR5_MCL1-03      aaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgg
I3JHR5_MCL1-02      aaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgg
I3JHR5_MCL1-01      aaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgg
                        **  * *  * ***    * *  ** *                 *** **      

I3KXG5_MCL1-01      --------ggaagacggttcgttgccgagcaccccgga----------------------
I3JHR5_MCL1-03      gaccgggaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatcc
I3JHR5_MCL1-02      gaccgggaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatcc
I3JHR5_MCL1-01      gaccgggaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatcc
                            ******************************                      

I3KXG5_MCL1-01      -----------------agaaactaaactcattattcacagttttttgggagactttact
I3JHR5_MCL1-03      gacgaggagctggagagagaaacgaaactccttattcacagttttttgggtgattttact
I3JHR5_MCL1-02      gacgaggagctggagagagaaacgaaactccttattcacagttttttgggtgattttact
I3JHR5_MCL1-01      gacgaggagctggagagagaaacgaaactccttattcacagttttttgggtgattttact
                                     ****** ****** ******************* ** ******

I3KXG5_MCL1-01      ggactttctcagcctcaacgaaaggaaaccaaagcactaaaaatgatgaaaagagttgtt
I3JHR5_MCL1-03      ggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacgatgaaaagagttgtt
I3JHR5_MCL1-02      ggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacgatgaaaagagttgtt
I3JHR5_MCL1-01      ggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacgatgaaaagagttgtt
                    ******************************************* ****************

I3KXG5_MCL1-01      gcggacgtattagaaaagcacagatatgcttacaacggaatgattaataaattgtcattg
I3JHR5_MCL1-03      gcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattg
I3JHR5_MCL1-02      gcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattg
I3JHR5_MCL1-01      gcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattg
                    ************************** ************************ ********

I3KXG5_MCL1-01      gatgaaagagaagaagatatgtcatt---------tgtagcgaagagcctctttggagac
I3JHR5_MCL1-03      gatgaaagacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagac
I3JHR5_MCL1-02      gatgaaagacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagac
I3JHR5_MCL1-01      gatgaaagacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagac
                    ********* * ** ***********         ******************** ****

I3KXG5_MCL1-01      cacacgaccaactggggtcgtattgtcagctttgtggccttcggggcagtggtgtctcag
I3JHR5_MCL1-03      cacacgaccaactggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag
I3JHR5_MCL1-02      cacacgaccaactggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag
I3JHR5_MCL1-01      cacacgaccaactggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag
                    ******************************************** ***************

I3KXG5_MCL1-01      cacctgaaggaaaagggcagggacaactgcgtggtgctagtgagtcaagagatttctgca
I3JHR5_MCL1-03      cacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaagaggtttctgca
I3JHR5_MCL1-02      cacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaagaggtttctgca
I3JHR5_MCL1-01      cacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaagaggtttctgca
                    ******************** ************* ********* ****** ********

I3KXG5_MCL1-01      tacttgctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttgtg
I3JHR5_MCL1-03      tacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtg
I3JHR5_MCL1-02      tacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtg
I3JHR5_MCL1-01      tacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtg
                    *** ************************** *****************************

I3KXG5_MCL1-01      gcgttcgttcgagtagcagaccctgagtcgatagtca-------ggaacacactcatgg-
I3JHR5_MCL1-03      gagttctttcgagtagcagaccctgagtccacgacccgggaggtggaatggacaaaagga
I3JHR5_MCL1-02      gagttctttcgagtagcagaccctgagtccacggtca-------ggaacacactcatgg-
I3JHR5_MCL1-01      gagttctttcgagtagcagaccctgagtccacggtca-------ggaacacactcatgg-
                    * **** ********************** *    *        ****   **  * ** 

I3KXG5_MCL1-01      ---------------cctttgctggatttgcttgtattggggcaacactggcactgttga
I3JHR5_MCL1-03      aaaatgtttcaaattacattatttaattcacagagat----------ctatttttgctaa
I3JHR5_MCL1-02      ---------------cctttgctggatttgctggtattggggcaacactggccctgttga
I3JHR5_MCL1-01      ---------------cctttgctggatttgctggtattggggcaacactggccctgttga
                                    * **  *  ***  *    **          **     ** * *

I3KXG5_MCL1-01      -----------------tcagg--------------------------------------
I3JHR5_MCL1-03      ------------------aagatgccataataaaaaggaaaaag----------------
I3JHR5_MCL1-02      tcaggacaaacactcactcaggtctcaggaagaaatggagagtgtctcgccatggtgatg
I3JHR5_MCL1-01      -----------------tcaggttctgggatgca--------------------------
                                       **                                       

I3KXG5_MCL1-01      ------------------------------------------------------------
I3JHR5_MCL1-03      ---------------acattttttttccttttttgctagtc-------------------
I3JHR5_MCL1-02      atccacagcaggcctcccctaatcttctcctgtggctaatgttatctaccacccaggtta
I3JHR5_MCL1-01      ------------------------------------------------------------
                                                                                

I3KXG5_MCL1-01      ----------------tga----------------------
I3JHR5_MCL1-03      ----------tttttttaa----------------------
I3JHR5_MCL1-02      cccctgtagttaactgtgaagaacacactggtagacaatag
I3JHR5_MCL1-01      ----------ttattgtga----------------------
                                    * *                      

© 1998-2020Legal notice