Dataset for CDS MCL-1 of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3KXG5_MCL1-01          ---------------atgtt------------------ctccttaaattg
A0A669C7T2_MCL1-03      atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagacta
A0A669C7T2_MCL1-01      atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagacta
A0A669C7T2_MCL1-02      atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagacta
                                       ****                   ** * ** * * 

I3KXG5_MCL1-01          ctgtctgtct--gagtggtgtcc---aaacaacgatgtgggctttataga
A0A669C7T2_MCL1-03      tcttcttcctcaaaatggagtcctggagggaccaat----gcactatgga
A0A669C7T2_MCL1-01      tcttcttcctcaaaatggagtcctggagggaccaat----gcactatgga
A0A669C7T2_MCL1-02      tcttcttcctcaaaatggagtcctggagggaccaat----gcactatgga
                           ***  **   * *** ****   *   * * **    **  *** **

I3KXG5_MCL1-01          taattgggaaaccctct--gtaggaaacc---tggtcttgttagg-----
A0A669C7T2_MCL1-03      t--cggggaaatcctctccgcagaatgccacaggctcctctaaagactct
A0A669C7T2_MCL1-01      t--cggggaaatcctctccgcagaatgccacaggctcctctaaagactct
A0A669C7T2_MCL1-02      t--cggggaaatcctctccgcagaatgccacaggctcctctaaagactct
                        *    ****** *****  * ** *  **    * ** * * * *     

I3KXG5_MCL1-01          agagacggcatc-----------catcccactttggatggagcagctc--
A0A669C7T2_MCL1-03      agcaacgggattgtgtctaatggtacccccaaacggccgaacaacctcgg
A0A669C7T2_MCL1-01      agcaacgggattgtgtctaatggtacccccaaacggccgaacaacctcgg
A0A669C7T2_MCL1-02      agcaacgggattgtgtctaatggtacccccaaacggccgaacaacctcgg
                        **  **** **             * ***     **  * *  * ***  

I3KXG5_MCL1-01          --tcatttcta----------------gaaatct--------------gg
A0A669C7T2_MCL1-03      ggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgggagg
A0A669C7T2_MCL1-01      ggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgggagg
A0A669C7T2_MCL1-02      ggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgggagg
                          * *  ** *                 *** **              **

I3KXG5_MCL1-01          aagacggttcgttgccgagcaccccgga----------------------
A0A669C7T2_MCL1-03      aagacggttcgttgccgagcaccccggagtatcatttggacggtgaatcc
A0A669C7T2_MCL1-01      aagacggttcgttgccgagcaccccggagtatcatttggacggtgaatcc
A0A669C7T2_MCL1-02      aagacggttcgttgccgagcaccccggagtatcatttggacggtgaatcc
                        ****************************                      

I3KXG5_MCL1-01          -----------------agaaactaaactcattattcacagttttttggg
A0A669C7T2_MCL1-03      gacgaggagctggagagagaaacgaaactccttattcacagttttttggg
A0A669C7T2_MCL1-01      gacgaggagctggagagagaaacgaaactccttattcacagttttttggg
A0A669C7T2_MCL1-02      gacgaggagctggagagagaaacgaaactccttattcacagttttttggg
                                         ****** ****** *******************

I3KXG5_MCL1-01          agactttactggactttctcagcctcaacgaaaggaaaccaaagcactaa
A0A669C7T2_MCL1-03      tgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaa
A0A669C7T2_MCL1-01      tgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaa
A0A669C7T2_MCL1-02      tgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaa
                         ** **********************************************

I3KXG5_MCL1-01          aaatgatgaaaagagttgttgcggacgtattagaaaagcacagatatgct
A0A669C7T2_MCL1-03      aaacgatgaaaagagttgttgcggacgtattagaaaagcacagatacgct
A0A669C7T2_MCL1-01      aaacgatgaaaagagttgttgcggacgtattagaaaagcacagatacgct
A0A669C7T2_MCL1-02      aaacgatgaaaagagttgttgcggacgtattagaaaagcacagatacgct
                        *** ****************************************** ***

I3KXG5_MCL1-01          tacaacggaatgattaataaattgtcattggatgaaagagaagaagatat
A0A669C7T2_MCL1-03      tacaacggaatgattaataaactgtcattggatgaaagacacgaggatat
A0A669C7T2_MCL1-01      tacaacggaatgattaataaactgtcattggatgaaagacacgaggatat
A0A669C7T2_MCL1-02      tacaacggaatgattaataaactgtcattggatgaaagacacgaggatat
                        ********************* ***************** * ** *****

I3KXG5_MCL1-01          gtcatt---------tgtagcgaagagcctctttggagaccacacgacca
A0A669C7T2_MCL1-03      gtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgacca
A0A669C7T2_MCL1-01      gtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgacca
A0A669C7T2_MCL1-02      gtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgacca
                        ******         ******************** **************

I3KXG5_MCL1-01          actggggtcgtattgtcagctttgtggccttcggggcagtggtgtctcag
A0A669C7T2_MCL1-03      actggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag
A0A669C7T2_MCL1-01      actggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag
A0A669C7T2_MCL1-02      actggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcag
                        ********************************** ***************

I3KXG5_MCL1-01          cacctgaaggaaaagggcagggacaactgcgtggtgctagtgagtcaaga
A0A669C7T2_MCL1-03      cacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaaga
A0A669C7T2_MCL1-01      cacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaaga
A0A669C7T2_MCL1-02      cacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaaga
                        ******************** ************* ********* *****

I3KXG5_MCL1-01          gatttctgcatacttgctgtctgaacagcgagactggattatcaaaaaca
A0A669C7T2_MCL1-03      ggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaaca
A0A669C7T2_MCL1-01      ggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaaca
A0A669C7T2_MCL1-02      ggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaaca
                        * *********** ************************** *********

I3KXG5_MCL1-01          atgcatgggatggctttgtggcgttcgttcgagtagcagaccctgagtcg
A0A669C7T2_MCL1-03      atgcatgggatggctttgtggagttctttcgagtagcagaccctgagtcc
A0A669C7T2_MCL1-01      atgcatgggatggctttgtggagttctttcgagtagcagaccctgagtcc
A0A669C7T2_MCL1-02      atgcatgggatggctttgtggagttctttcgagtagcagaccctgagtcc
                        ********************* **** ********************** 

I3KXG5_MCL1-01          atagtca-------ggaacacactcatgg----------------ccttt
A0A669C7T2_MCL1-03      acgacccgggaggtggaatggacaaaaggaaaaatgtttcaaattacatt
A0A669C7T2_MCL1-01      acggtca-------ggaacacactcatgg----------------ccttt
A0A669C7T2_MCL1-02      acggtca-------ggaacacactcatgg----------------ccttt
                        *    *        ****   **  * **                 * **

I3KXG5_MCL1-01          gctggatttgcttgtattggggcaacactggcactgttga----------
A0A669C7T2_MCL1-03      atttaattcacagagat----------ctatttttgctaa----------
A0A669C7T2_MCL1-01      gctggatttgctggtattggggcaacactggccctgttga----------
A0A669C7T2_MCL1-02      gctggatttgctggtattggggcaacactggccctgttgatcaggacaaa
                          *  ***  *    **          **     ** * *          

I3KXG5_MCL1-01          -------tcagg--------------------------------------
A0A669C7T2_MCL1-03      --------aagatgccataataaaaaggaaaaag----------------
A0A669C7T2_MCL1-01      -------tcaggttctgggatgca--------------------------
A0A669C7T2_MCL1-02      cactcactcaggtctcaggaagaaatggagagtgtctcgccatggtgatg
                                 **                                       

I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      ---------------acattttttttccttttttgctagtc---------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      atccacagcaggcctcccctaatcttctcctgtggctaatgttatctacc
                                                                          

I3KXG5_MCL1-01          --------------------------tga---------------------
A0A669C7T2_MCL1-03      --------------------tttttttaa---------------------
A0A669C7T2_MCL1-01      --------------------ttattgtga---------------------
A0A669C7T2_MCL1-02      acccaggttacccctgtagttaactgtgaagaacacactggtagacaata
                                                  * *                     

I3KXG5_MCL1-01          -
A0A669C7T2_MCL1-03      -
A0A669C7T2_MCL1-01      -
A0A669C7T2_MCL1-02      g
                         

© 1998-2022Legal notice