Dataset for CDS BCL2L1 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8I3ZZI7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A8I3ZZI7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                        **************************************************

A0A8I3ZZI7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A8I3ZZI7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                        **************************************************

A0A8I3ZZI7_BCL2L1-      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
A0A8I3ZZI7_BCL2L1-      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
                        **************************************************

A0A8I3ZZI7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagcccagtggtgaatgg
A0A8I3ZZI7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagcccagtggtgaatgg
                        **************************************************

A0A8I3ZZI7_BCL2L1-      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A8I3ZZI7_BCL2L1-      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
                        **************************************************

A0A8I3ZZI7_BCL2L1-      cagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcgg
A0A8I3ZZI7_BCL2L1-      cagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcgg
                        **************************************************

A0A8I3ZZI7_BCL2L1-      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
A0A8I3ZZI7_BCL2L1-      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
                        **************************************************

A0A8I3ZZI7_BCL2L1-      gacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
A0A8I3ZZI7_BCL2L1-      gacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
                        **************************************************

A0A8I3ZZI7_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A8I3ZZI7_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                        **************************************************

A0A8I3ZZI7_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A8I3ZZI7_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        **************************************************

A0A8I3ZZI7_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A8I3ZZI7_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                        **************************************************

A0A8I3ZZI7_BCL2L1-      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca
A0A8I3ZZI7_BCL2L1-      agaacggcggctgga------tgaaggtgatctttcaaatctcctctgca
                        **************       *   **   *** *  ** *    * ***

A0A8I3ZZI7_BCL2L1-      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A8I3ZZI7_BCL2L1-      ---gagatccaatggg----------------------------------
                           **** ** *  **                                  

A0A8I3ZZI7_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat
A0A8I3ZZI7_BCL2L1-      -ataatggtgactacca----tttattgagc-----atctag--------
                         ** *  *** *   *     * *  ** **      * ***        

A0A8I3ZZI7_BCL2L1-      ga
A0A8I3ZZI7_BCL2L1-      --
                          

© 1998-2023Legal notice