Dataset for CDS BCL2L1 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7IT36_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
F7IT36_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

F7IT36_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
F7IT36_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                      **************************************************

F7IT36_BCL2L1-01      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
F7IT36_BCL2L1-02      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
                      **************************************************

F7IT36_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagcccagtggtgaatgg
F7IT36_BCL2L1-02      atcaatggcaacccatcctggcacctggcggacagcccagtggtgaatgg
                      **************************************************

F7IT36_BCL2L1-01      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
F7IT36_BCL2L1-02      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
                      **************************************************

F7IT36_BCL2L1-01      cagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcgg
F7IT36_BCL2L1-02      cagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcgg
                      **************************************************

F7IT36_BCL2L1-01      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
F7IT36_BCL2L1-02      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
                      **************************************************

F7IT36_BCL2L1-01      gacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
F7IT36_BCL2L1-02      gacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
                      **************************************************

F7IT36_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
F7IT36_BCL2L1-02      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                      **************************************************

F7IT36_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
F7IT36_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                      **************************************************

F7IT36_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
F7IT36_BCL2L1-02      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                      **************************************************

F7IT36_BCL2L1-01      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca
F7IT36_BCL2L1-02      agaacggcggctgga------tgaaggtgatctttcaaatctcctctgca
                      **************       *   **   *** *  ** *    * ***

F7IT36_BCL2L1-01      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
F7IT36_BCL2L1-02      ---gagatccaatggg----------------------------------
                         **** ** *  **                                  

F7IT36_BCL2L1-01      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat
F7IT36_BCL2L1-02      -ataatggtgactacca----tttattgagc-----atctag--------
                       ** *  *** *   *     * *  ** **      * ***        

F7IT36_BCL2L1-01      ga
F7IT36_BCL2L1-02      --
                        

© 1998-2022Legal notice