Dataset for CDS BAX of Organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1P637_BAX-01      atggcagatgccaacgatggcgagagggtagacgaaaacgagctgagggg
A0A8C1P637_BAX-02      atggcagatgccaacgatggcgagagggtagacgaaaacgagctgagggg
X4ZER0_BAX-01          atggcag---------------------------------cgccgtcggg
A0A8C1PYL4_BAX-03      atggcag---------------------------------cgccgtcggg
A0A8C1PYL4_BAX-01      atgg-gt---------------------------------tgctgtcgat
A0A8C1PYL4_BAX-02      atg-----------------------------------------------
                       ***                                               

A0A8C1P637_BAX-01      ggctgccggtggtgaagatgtcatgg---atgaggtgatcatcgaacagg
A0A8C1P637_BAX-02      ggctgccggtggtgaagatgtcatgg---atgaggtgatcatcgaacagg
X4ZER0_BAX-01          cggaggcgatacg------ggcactggcaatgaccagataattgccttgg
A0A8C1PYL4_BAX-03      tggaggcgatacggtagaaggcattggcaatgagcagattatttccttgg
A0A8C1PYL4_BAX-01      t--------taaagtagaaggcattggcaatgagcagattatttccttgg
A0A8C1PYL4_BAX-02      -------------gcaggggtgtctgatcctg------------cttctg
                                          *     *    **                 *

A0A8C1P637_BAX-01      gtgcagttctactaagagggtatgttattgaacgagttactgtagagcat
A0A8C1P637_BAX-02      gtgcagttctactaagagggtatgttattgaacgagttactgtagagcat
X4ZER0_BAX-01          gatctgtacttctcaataacttcgtctatgaacgagtt---------cgt
A0A8C1PYL4_BAX-03      gagctgcacttctcaataacttcatctatgaacgagtt---------cgt
A0A8C1PYL4_BAX-01      gagctgcacttctcaataacttcatctatgaacgagtt---------cgt
A0A8C1PYL4_BAX-02      gagggtcact---------cttcatctatgaacgagtt---------cgt
                       *       **          *   *   **********         * *

A0A8C1P637_BAX-01      ccagctattcgtgtgagccatgaggatttaggaggacgacctcaggaagc
A0A8C1P637_BAX-02      ccagctattcgtgtgagccatgaggatttaggaggacgacctcaggaagc
X4ZER0_BAX-01          c------gttatggggacagcgaagctgaagtaacccgaagtcagctggg
A0A8C1PYL4_BAX-03      c------gccatggagacagtgaagctgaattaacccgaagtcagctggg
A0A8C1PYL4_BAX-01      c------gccatggagacagtgaagctgaattaacccgaagtcagctggg
A0A8C1PYL4_BAX-02      c------gccatggagacagtgaagctgaattaacccgaagtcagctggg
                       *          **    *   ** * *  *  *   ***  ****   * 

A0A8C1P637_BAX-01      agatgat----------cctcaaatcaaagaggttgtagatcaactttt-
A0A8C1P637_BAX-02      agatgat----------cctcaaatcaaagaggttgtagatcaactttt-
X4ZER0_BAX-01          tggtgttgagctgtgcgaccccaaccataaacgtc-tagggcagtgctta
A0A8C1PYL4_BAX-03      tggtgttgagctgtgcgaccccagccataaacgtc-ttgcgcagtgtttg
A0A8C1PYL4_BAX-01      tggtgttgagctgtgcgaccccagccataaacgtc-ttgcgcagtgtttg
A0A8C1PYL4_BAX-02      tggtgttgagctgtgcgaccccagccataaacgtc-ttgcgcagtgtttg
                        * ** *           * * *  ** * * **  * *  **    ** 

A0A8C1P637_BAX-01      --gaagatagccgacgaccttaacaagaatgctgaactgcaacatctcat
A0A8C1P637_BAX-02      --gaagatagccgacgaccttaacaagaatgctgaactgcaacatctcat
X4ZER0_BAX-01          cagcaaattggagatgagctggatggaaatgtgcagctgcaaagtatggt
A0A8C1PYL4_BAX-03      cagcagattggagatgagctggatggaaatgtgcagctgcaaagtatgtt
A0A8C1PYL4_BAX-01      cagcagattggagatgagctggatggaaatgtgcagctgcaaagtatgtt
A0A8C1PYL4_BAX-02      cagcagattggagatgagctggatggaaatgtgcagctgcaaagtatgtt
                         * * ** *  ** ** **  *    ****   * ******  * *  *

A0A8C1P637_BAX-01      cag------cactgtgcaatcaaactgcgctcaggacgtcttcatgactg
A0A8C1P637_BAX-02      cag------cactgtgcaatcaaactgcgctcaggacgtcttcatgactg
X4ZER0_BAX-01          aaatgaccctgctcttcagccaa------ctcaagaagtcttcatgaaag
A0A8C1PYL4_BAX-03      aaatgactccactcttcaaccaa------ctcaagaagtcttcatgaaag
A0A8C1PYL4_BAX-01      aaatgactccactcttcaaccaa------ctcaagaagtcttcatgaaag
A0A8C1PYL4_BAX-02      aaatgactccactcttcaaccaa------ctcaagaagtcttcatgaaag
                        *         ** * **  ***      **** ** **********  *

A0A8C1P637_BAX-01      tggccaggagcatctttgaggatggca---ttaactggggacgtattgtg
A0A8C1P637_BAX-02      tggccaggagcatctttgaggatggca---ttaactggggacgtattgtg
X4ZER0_BAX-01          tggcccgagagatcttctctgatgggaagttcaactggggcagagtggtg
A0A8C1PYL4_BAX-03      tggcccgcgagatcttctctgatgggaagttcaactggggcagagtggtg
A0A8C1PYL4_BAX-01      tggcccgcgagatcttctctgatgggaagttcaactggggcagagtggtg
A0A8C1PYL4_BAX-02      tggcccgcgagatcttctctgatgggaagttcaactggggcagagtggtg
                       ***** *    *****    ***** *   * ********  *  * ***

A0A8C1P637_BAX-01      gcactgtttcacctcgcgtataggctcatttaccaggctctgactcagaa
A0A8C1P637_BAX-02      gcactgtttcacctcgcgtataggctcatttaccaggctctgactcagaa
X4ZER0_BAX-01          gcgcttttctactttgcgtgtcggcttgtcgtcaaggctattacaaacaa
A0A8C1PYL4_BAX-03      gcgcttttctactttgcgtgtcggcttgtcatcaaggctattataaccaa
A0A8C1PYL4_BAX-01      gcgcttttctactttgcgtgtcggcttgtcatcaaggctattataaccaa
A0A8C1PYL4_BAX-02      gcgcttttctactttgcgtgtcggcttgtcatcaaggctattataaccaa
                       ** ** **  ** * **** * ****  *   * ***** * *     **

A0A8C1P637_BAX-01      ccactttgacattatcaagaggatcattagctgggttttacagtttatca
A0A8C1P637_BAX-02      ccactttgacattatcaagaggatcattagctgggttttacagtttatca
X4ZER0_BAX-01          gattcgtgacatcatcagaaccatcataagctggactatgtcctacattc
A0A8C1PYL4_BAX-03      gattcctgacatcataagaaccatcataaactggactatgtcctacattc
A0A8C1PYL4_BAX-01      gattcctgacatcataagaaccatcataaactggactatgtcctacattc
A0A8C1PYL4_BAX-02      gattcctgacatcataagaaccatcataaactggactatgtcctacattc
                             ****** ** *  *  ***** * ****  * *    *  **  

A0A8C1P637_BAX-01      aggaaaacatttctgtctggatcagacagcaaggaggatgggagggcatt
A0A8C1P637_BAX-02      aggaaaacatttctgtctggatcagacagcaaggaggatgggtaagttgc
X4ZER0_BAX-01          aggaacacgttattaactggatcagggaacagggtggatggaacgctgac
A0A8C1PYL4_BAX-03      aggaacacgttattacctggatcagggaacagggtggatggaacgctgac
A0A8C1PYL4_BAX-01      aggaacacgttattacctggatcagggaacagggtggatgggagggaatc
A0A8C1PYL4_BAX-02      aggaacacgttattacctggatcagggaacagggtggatgggagggaatc
                       ***** ** **  *  *********  * ** ** ******         

A0A8C1P637_BAX-01      ttccgcaacgtgtcaagatggcgtactgtgt-------------------
A0A8C1P637_BAX-02      tgtttgtgtgtgtgcgtctggccacccatgtggagccacacaggtcgagc
X4ZER0_BAX-01          tgtttctatagc--aactgggacgcttcta--------------------
A0A8C1PYL4_BAX-03      tgtttctatagc--aaccgggacgcttcta--------------------
A0A8C1PYL4_BAX-01      cgctcctatttcggaaccccaacatggcag--------------------
A0A8C1PYL4_BAX-02      cgctcctatttcggaaccccaacatggcag--------------------
                                                                         

A0A8C1P637_BAX-01      ----------ctttcat-cgctgcgatg-gcattcattgcagctgt----
A0A8C1P637_BAX-02      cagacatgggccaccacacacagagagacgcacccacttgggccaggaag
X4ZER0_BAX-01          ----------actgcagctgcagtgacgtgctgactttaccgattagcga
A0A8C1PYL4_BAX-03      ----------actgcagctgcagtgacgtgctgactttaccgattagcga
A0A8C1PYL4_BAX-01      ----------act--------attggcgt------tttcctggccgggg-
A0A8C1PYL4_BAX-02      ----------act--------attggcgt------tttcctggccgggg-
                                               *            *   *        

A0A8C1P637_BAX-01      ------------------------tgtttactggaga-----------ag
A0A8C1P637_BAX-02      tacataagcacaaacccagacacatgccttctaggaatatccagacacaa
X4ZER0_BAX-01          t-----------------------tggctccttcattcagaaggcggggc
A0A8C1PYL4_BAX-03      t-----------------------tggctccttcattcagaaggcggggc
A0A8C1PYL4_BAX-01      ------------------------tgctcaccacagtt-----gtggtga
A0A8C1PYL4_BAX-02      ------------------------tgctcaccacagtt-----gtggtga
                                               **    *                   

A0A8C1P637_BAX-01      aacgcgt----taa-----
A0A8C1P637_BAX-02      aacccac----tgacttag
X4ZER0_BAX-01          ttcctgcgat-tga-----
A0A8C1PYL4_BAX-03      ttcctgcgat-tga-----
A0A8C1PYL4_BAX-01      tgcgcaaaatgtga-----
A0A8C1PYL4_BAX-02      tgcgcaaaatgtga-----
                         *        * *     

© 1998-2023Legal notice