Dataset for CDS BAX of Organism Cyprinus carpio

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C1P637_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio GN=BAX (length=615 residues).
atggcagatgccaacgatggcgagagggtagacgaaaacgagctgaggggggctgccggtggtgaagatgtcatggatga
ggtgatcatcgaacagggtgcagttctactaagagggtatgttattgaacgagttactgtagagcatccagctattcgtg
tgagccatgaggatttaggaggacgacctcaggaagcagatgatcctcaaatcaaagaggttgtagatcaacttttgaag
atagccgacgaccttaacaagaatgctgaactgcaacatctcatcagcactgtgcaatcaaactgcgctcaggacgtctt
catgactgtggccaggagcatctttgaggatggcattaactggggacgtattgtggcactgtttcacctcgcgtataggc
tcatttaccaggctctgactcagaaccactttgacattatcaagaggatcattagctgggttttacagtttatcaaggaa
aacatttctgtctggatcagacagcaaggaggatgggagggcattttccgcaacgtgtcaagatggcgtactgtgtcttt
catcgctgcgatggcattcattgcagctgttgtttactggagaagaacgcgttaa
>gnl|bcl2dbcds|A0A8C1P637_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio GN=BAX (length=690 residues).
atggcagatgccaacgatggcgagagggtagacgaaaacgagctgaggggggctgccggtggtgaagatgtcatggatga
ggtgatcatcgaacagggtgcagttctactaagagggtatgttattgaacgagttactgtagagcatccagctattcgtg
tgagccatgaggatttaggaggacgacctcaggaagcagatgatcctcaaatcaaagaggttgtagatcaacttttgaag
atagccgacgaccttaacaagaatgctgaactgcaacatctcatcagcactgtgcaatcaaactgcgctcaggacgtctt
catgactgtggccaggagcatctttgaggatggcattaactggggacgtattgtggcactgtttcacctcgcgtataggc
tcatttaccaggctctgactcagaaccactttgacattatcaagaggatcattagctgggttttacagtttatcaaggaa
aacatttctgtctggatcagacagcaaggaggatgggtaagttgctgtttgtgtgtgtgcgtctggccacccatgtggag
ccacacaggtcgagccagacatgggccaccacacacagagagacgcacccacttgggccaggaagtacataagcacaaac
ccagacacatgccttctaggaatatccagacacaaaacccactgacttag
>gnl|bcl2dbcds|A0A8C1PYL4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio GN=BAX (length=576 residues).
atgggttgctgtcgatttaaagtagaaggcattggcaatgagcagattatttccttgggagctgcacttctcaataactt
catctatgaacgagttcgtcgccatggagacagtgaagctgaattaacccgaagtcagctgggtggtgttgagctgtgcg
accccagccataaacgtcttgcgcagtgtttgcagcagattggagatgagctggatggaaatgtgcagctgcaaagtatg
ttaaatgactccactcttcaaccaactcaagaagtcttcatgaaagtggcccgcgagatcttctctgatgggaagttcaa
ctggggcagagtggtggcgcttttctactttgcgtgtcggcttgtcatcaaggctattataaccaagattcctgacatca
taagaaccatcataaactggactatgtcctacattcaggaacacgttattacctggatcagggaacagggtggatgggag
ggaatccgctcctatttcggaaccccaacatggcagactattggcgttttcctggccggggtgctcaccacagttgtggt
gatgcgcaaaatgtga
>gnl|bcl2dbcds|A0A8C1PYL4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio GN=BAX (length=537 residues).
atggcaggggtgtctgatcctgcttctggagggtcactcttcatctatgaacgagttcgtcgccatggagacagtgaagc
tgaattaacccgaagtcagctgggtggtgttgagctgtgcgaccccagccataaacgtcttgcgcagtgtttgcagcaga
ttggagatgagctggatggaaatgtgcagctgcaaagtatgttaaatgactccactcttcaaccaactcaagaagtcttc
atgaaagtggcccgcgagatcttctctgatgggaagttcaactggggcagagtggtggcgcttttctactttgcgtgtcg
gcttgtcatcaaggctattataaccaagattcctgacatcataagaaccatcataaactggactatgtcctacattcagg
aacacgttattacctggatcagggaacagggtggatgggagggaatccgctcctatttcggaaccccaacatggcagact
attggcgttttcctggccggggtgctcaccacagttgtggtgatgcgcaaaatgtga
>gnl|bcl2dbcds|A0A8C1PYL4_BAX-03 BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio GN=BAX (length=603 residues).
atggcagcgccgtcgggtggaggcgatacggtagaaggcattggcaatgagcagattatttccttgggagctgcacttct
caataacttcatctatgaacgagttcgtcgccatggagacagtgaagctgaattaacccgaagtcagctgggtggtgttg
agctgtgcgaccccagccataaacgtcttgcgcagtgtttgcagcagattggagatgagctggatggaaatgtgcagctg
caaagtatgttaaatgactccactcttcaaccaactcaagaagtcttcatgaaagtggcccgcgagatcttctctgatgg
gaagttcaactggggcagagtggtggcgcttttctactttgcgtgtcggcttgtcatcaaggctattataaccaagattc
ctgacatcataagaaccatcataaactggactatgtcctacattcaggaacacgttattacctggatcagggaacagggt
ggatggaacgctgactgtttctatagcaaccgggacgcttctaactgcagctgcagtgacgtgctgactttaccgattag
cgattggctccttcattcagaaggcggggcttcctgcgattga
>gnl|bcl2dbcds|X4ZER0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio GN=BAX (length=597 residues).
atggcagcgccgtcgggcggaggcgatacgggcactggcaatgaccagataattgccttgggatctgtacttctcaataa
cttcgtctatgaacgagttcgtcgttatggggacagcgaagctgaagtaacccgaagtcagctgggtggtgttgagctgt
gcgaccccaaccataaacgtctagggcagtgcttacagcaaattggagatgagctggatggaaatgtgcagctgcaaagt
atggtaaatgaccctgctcttcagccaactcaagaagtcttcatgaaagtggcccgagagatcttctctgatgggaagtt
caactggggcagagtggtggcgcttttctactttgcgtgtcggcttgtcgtcaaggctattacaaacaagattcgtgaca
tcatcagaaccatcataagctggactatgtcctacattcaggaacacgttattaactggatcagggaacagggtggatgg
aacgctgactgtttctatagcaactgggacgcttctaactgcagctgcagtgacgtgctgactttaccgattagcgattg
gctccttcattcagaaggcggggcttcctgcgattga
© 1998-2023Legal notice