Dataset for CDS BAK1 of Organism Anolis carolinensis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A803TLD5_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anolis carolinensis GN=BAK1 (length=747 residues).
atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagatacgcagaccatccatggaaattgcattaga
agaccaggtggctcaggagacggaggaggtgttccagagctacgctttctaccggtatcaacaggagcgggagcagactg
agggggatgtgccacatgacccagaaatagctgcgatcccgcatgagccaaatagcacaaattgccaggtgggcaggcgc
ctggccactattggtgatgacatcaatgcccgctatgacaaggagttctcggaaatgttgaagtcactccagccaacaaa
ggacaacgcctatgagtactttattagaatagccagcagtttgtttgaaagtggcataaactggggccgtgtgatagcac
tgttgggcttcggctacaggatggcgatccatgtataccagcatgggatgaccggcttcctgaggagaattgcccgctac
atggctgattttgtgcttcgcaaccgcattgcccggtggattgctcagcagggcggatgggtaggtggacctgaaagcca
aattagtgttctttgtgcaggacttccaccactgccacctcagatactcctgatttcttttgaccatgaggaatatgagg
aaacacagcctctgaacagatgtggtgggaagatgatatcattcactttgtggaattcttggtatttgattatgctggac
agtgttcagtgttttaccttgttttaa
>gnl|bcl2dbcds|A0A803TLD5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anolis carolinensis GN=BAK1 (length=645 residues).
atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagatacgcagaccatccatggaaattgcattaga
agaccaggtggctcaggagacggaggaggtgttccagagctacgctttctaccggtatcaacaggagcgggagcagactg
agggggatgtgccacatgacccagaaatagctgcgatcccgcatgagccaaatagcacaaattgccaggtgggcaggcgc
ctggccactattggtgatgacatcaatgcccgctatgacaaggagttctcggaaatgttgaagtcactccagccaacaaa
ggacaacgcctatgagtactttattagaatagccagcagtttgtttgaaagtggcataaactggggccgtgtgatagcac
tgttgggcttcggctacaggatggcgatccatgtataccagcatgggatgaccggcttcctgaggagaattgcccgctac
atggctgattttgtgcttcgcaaccgcattgcccggtggattgctcagcagggcggatgggtggcagcactggacttaag
caacgtgtacttgaagtatgtgctgatagtggcggctgtgatcttgctaggccagtttgtggtgcggcgtttcttcaacc
catga
© 1998-2023Legal notice